Stem-loop hsa-mir-328

Accession

MI0000804

Symbol

HGNC: MIR328

Description

Homo sapiens hsa-mir-328 precursor miRNA mir-328

Gene
family

RF00772; mir-328

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR328 is a microRNA implicated in various cellular processes and disease states [PMC7912829]. It has been identified as a regulator of gene expression, including the regulation of GNG7 expression, potentially through a common upstream factor shared with miR15a [PMC2361448]. In chronic myeloid leukemia (CML) cell lines, the knockdown of endogenous MIR328 has been associated with increased resistance to the drug imatinib, whereas increasing MIR328 levels through exosomal delivery can sensitize these cells to the treatment [PMC7912829]. MIR328 is also reported to regulate untranslated PIM1 and other PIM kinases, which are involved in cell survival and proliferation [PMC8125027]. Furthermore, MIR328 interacts with various biomolecules including protein-coding genes and other non-coding RNAs as identified by its interaction with HNRNPK [PMC9730017]. In pathological conditions such as kidney disease and heart valve disease, MIR328 levels have been found to be altered, suggesting its role in these diseases' progression [PMC4068774], [PMC7197751]. Additionally, MIR328 has been studied for its potential as a biomarker in traumatic brain injury (TBI), highlighting its diagnostic relevance in neurology [PMC7327940].

Literature search

110 open access papers mention hsa-mir-328
(565 sentences)

Sequence

8042 reads, 88 reads per million, 119 experiments

uggaguGGGGGGGCAGGAGGGGCUCAGGGagaaagugcauacagcccCUGGCCCUCUCUGCCCUUCCGUccccug
.(((.((((((((((((.(((((.(((((.......((.....)))))))))))).)))))))))))))))....

Structure

---u   g            A     U     agaaagu  a 
    gga uGGGGGGGCAGG GGGGC CAGGG       gc u
    ||| |||||||||||| ||||| |||||       || a
    ccU GCCUUCCCGUCU UCCCG GUCcc       cg c
gucc   -            C     -     -------  a 

Annotation confidence Not enough data

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context

chr16: 67202321-67202395 [-]

Mature hsa-miR-328-3p

• Accession: MIMAT0000752
• Description: Homo sapiens hsa-miR-328-3p mature miRNA
• Sequence: 48 - CUGGCCCUCUCUGCCCUUCCGU - 69
• Evidence: experimental ; cloned [3], Illumina [4]

Mature hsa-miR-328-5p

• Accession: MIMAT0026486
• Description: Homo sapiens hsa-miR-328-5p mature miRNA
• Sequence: 7 - GGGGGGGCAGGAGGGGCUCAGGG - 29
• Evidence: experimental ; Illumina [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45