Stem-loop hsa-mir-328

Accession

MI0000804

Symbol

HGNC: MIR328

Description

Homo sapiens hsa-mir-328 precursor miRNA mir-328

Gene
family

RF00772; mir-328

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR328 is a microRNA that has been found to play a role in various biological processes [PMC2361448]. It has been shown that a common upstream factor may control both MIR328 and miR15a to regulate GNG7 expression [PMC2361448]. In the context of chronic myeloid leukemia (CML), endogenous MIR328 knockdown induced imatinib resistance, while in-vitro delivery of alkalized exosomes, with or without exosomal MIR328, increased endogenous MIR328 levels and sensitized CML cells to imatinib [PMC7912829]. Additionally, MIR328 is reported as a regulator of untranslated PIM1 or other PIM kinases, along with the miR-1/206 cluster, miR33-5p, and miR486-5p [PMC8125027]. HNRNPK has been found to interact with several genes and non-coding RNAs including MIR328 [PMC9730017]. In the context of kidney disease, reduced expression of MIR328 was observed in UUO kidneys compared to normal kidneys [PMC4068774]. Furthermore, reduced levels of MIR328 were also found in diseased heart valves [PMC7197751]. Finally, in the context of traumatic brain injury (TBI), the diagnostic potential of several microRNAs including MIR328 was explored in cerebrospinal fluid and sera samples from patients experiencing different grades of TBI [PMC7327940].

Literature search

110 open access papers mention hsa-mir-328
(565 sentences)

Sequence

8042 reads, 88 reads per million, 119 experiments

uggaguGGGGGGGCAGGAGGGGCUCAGGGagaaagugcauacagcccCUGGCCCUCUCUGCCCUUCCGUccccug
.(((.((((((((((((.(((((.(((((.......((.....)))))))))))).)))))))))))))))....

Structure

---u   g            A     U     agaaagu  a 
    gga uGGGGGGGCAGG GGGGC CAGGG       gc u
    ||| |||||||||||| ||||| |||||       || a
    ccU GCCUUCCCGUCU UCCCG GUCcc       cg c
gucc   -            C     -     -------  a 

Annotation confidence Not enough data

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context

chr16: 67202321-67202395 [-]

Mature hsa-miR-328-3p

• Accession: MIMAT0000752
• Description: Homo sapiens hsa-miR-328-3p mature miRNA
• Sequence: 48 - CUGGCCCUCUCUGCCCUUCCGU - 69
• Evidence: experimental ; cloned [3], Illumina [4]

Mature hsa-miR-328-5p

• Accession: MIMAT0026486
• Description: Homo sapiens hsa-miR-328-5p mature miRNA
• Sequence: 7 - GGGGGGGCAGGAGGGGCUCAGGG - 29
• Evidence: experimental ; Illumina [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45