MIR328 is a microRNA that has been found to play a role in various biological processes [PMC2361448]. It has been shown that a common upstream factor may control both MIR328 and miR15a to regulate GNG7 expression [PMC2361448]. In the context of chronic myeloid leukemia (CML), endogenous MIR328 knockdown induced imatinib resistance, while in-vitro delivery of alkalized exosomes, with or without exosomal MIR328, increased endogenous MIR328 levels and sensitized CML cells to imatinib [PMC7912829]. Additionally, MIR328 is reported as a regulator of untranslated PIM1 or other PIM kinases, along with the miR-1/206 cluster, miR33-5p, and miR486-5p [PMC8125027]. HNRNPK has been found to interact with several genes and non-coding RNAs including MIR328 [PMC9730017]. In the context of kidney disease, reduced expression of MIR328 was observed in UUO kidneys compared to normal kidneys [PMC4068774]. Furthermore, reduced levels of MIR328 were also found in diseased heart valves [PMC7197751]. Finally, in the context of traumatic brain injury (TBI), the diagnostic potential of several microRNAs including MIR328 was explored in cerebrospinal fluid and sera samples from patients experiencing different grades of TBI [PMC7327940].
---u g A U agaaagu a gga uGGGGGGGCAGG GGGGC CAGGG gc u ||| |||||||||||| ||||| ||||| || a ccU GCCUUCCCGUCU UCCCG GUCcc cg c gucc - C - ------- a
Accession | MIMAT0000752 |
Description | Homo sapiens hsa-miR-328-3p mature miRNA |
Sequence | 48 - CUGGCCCUCUCUGCCCUUCCGU - 69 |
Evidence |
experimental
cloned [3], Illumina [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026486 |
Description | Homo sapiens hsa-miR-328-5p mature miRNA |
Sequence | 7 - GGGGGGGCAGGAGGGGCUCAGGG - 29 |
Evidence |
experimental
Illumina [4] |
|