MIR337 is a microRNA that has been associated with head and neck cancers [PMC5354851]. However, it was not detected in the study mentioned in the first sentence [PMC5354851]. In another study, MIR337 was found to be down-regulated in males and up-regulated in females [PMC7663125]. MIR337 is transcribed from the maternal chromosome along with other microRNAs along the Dlk1-Dio3 imprinted domain [PMC3919614]. In esophageal cancer cell lines, over-expression of MIR337 was found to increase the conversion of LC3-I to LC3-II [PMC5302951]. The expression of MIR337 was significantly decreased in a study examining multiple miRNAs, and therefore it was not further examined using quantitative RT-PCR [PMC4748271]. Additionally, MIR337 has been implicated in controlling chondrogenesis of mesenchymal stem cells and the progression of osteoarthritis [PMC10110697]. References: - [PMC5354851]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5354851/ - [PMC7663125]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7663125/ - [PMC3919614]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3919614/ - [PMC5302951]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5302951/ - [PCM4748271]: https://www.ncbi.nlm.nih.gov/pmc/articles/PCM4748271/ - [PCM10110697]: https://www.ncbi.nlm.nih.gov/pmc/articles/PCM10110697/
guagucaguaguu - C U C - ca ggggggugg GAA GGC UCAUA AGGAGUUg aug c ||||||||| ||| ||| ||||| |||||||| ||| uccccuaCU CUU CCG AGUAU UCCUCgac uau a ---------aacu U U U A c ug
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004695 |
Description | Homo sapiens hsa-miR-337-5p mature miRNA |
Sequence | 23 - GAACGGCUUCAUACAGGAGUU - 43 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
Accession | MIMAT0000754 |
Description | Homo sapiens hsa-miR-337-3p mature miRNA |
Sequence | 61 - CUCCUAUAUGAUGCCUUUCUUC - 82 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|