Stem-loop hsa-mir-326

Accession

MI0000808

Symbol

HGNC: MIR326

Description

Homo sapiens hsa-mir-326 precursor miRNA mir-326

Gene
family

RF00719; mir-326

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR326 is a microRNA that has been associated with progression-free survival (PFS) in certain cases, such as miR155, miR210, and miR130a [PMC7073212]. It has been found that miR29a targets HIV-1 US vRNA and leads to translational repression, while miR133b, miR138-5, MIR326, miR149-5p, and miR92a-3p have been shown to reduce HIV-1 replication [PMC9237370]. Additionally, the expression of MIR326 negatively correlates with HIV-1 infection [PMC9237370].

Literature search

75 open access papers mention hsa-mir-326
(392 sentences)

Sequence

1560 reads, 29 reads per million, 90 experiments

cucaucugucuguugggcuggaggcagggccuuugugaaggcggguggugcucagaucgCCUCUGGGCCCUUCCUCCAGccccgaggcggauuca
...((((((((...((((((((((.(((((((......((((((.((.....))..))))))..))))))).))))))))))..))))))))...

Structure

cuc        guu          c       uuguga      -g  g 
   aucugucu   gggcuggagg agggccu      aggcgg  ug u
   ||||||||   |||||||||| |||||||      ||||||  || g
   uaggcgga   cccGACCUCC UCCCGGG      UCCgcu  ac c
acu        -gc          U       ----UC      ag  u 

Annotation confidence Not enough data

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. miR-326 cloned in [3] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context

chr11: 75335092-75335186 [-]

Disease association

hsa-mir-326 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-326

• Accession: MIMAT0000756
• Description: Homo sapiens hsa-miR-326 mature miRNA
• Sequence: 60 - CCUCUGGGCCCUUCCUCCAG - 79
• Evidence: experimental ; cloned [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365