WARNING: This summary was generated by AI. MIR326 is a microRNA implicated in the regulation of immune responses and has been associated with various diseases [PMC9237370]. In the context of HIV-1 infection, MIR326 is one of the microRNAs that have been shown to reduce HIV-1 replication, suggesting a potential role in antiviral defense mechanisms [PMC9237370]. Additionally, MIR326 has been linked to progression-free survival (PFS) in patients, indicating its potential as a prognostic biomarker [PMC7073212]. The involvement of MIR326 in both the suppression of HIV-1 replication and its correlation with PFS underscores its significance in disease progression and patient outcomes [PMC7073212; PMC9237370]..
cuc guu c uuguga -g g aucugucu gggcuggagg agggccu aggcgg ug u |||||||| |||||||||| ||||||| |||||| || g uaggcgga cccGACCUCC UCCCGGG UCCgcu ac c acu -gc U ----UC ag u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000756 |
| Description | Homo sapiens hsa-miR-326 mature miRNA |
| Sequence | 60 - CCUCUGGGCCCUUCCUCCAG - 79 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|