miRBase entry: hsa-mir-326

Stem-loop hsa-mir-326


Accession
MI0000808
Symbol
HGNC: MIR326
Description
Homo sapiens hsa-mir-326 precursor miRNA mir-326
Gene
family?
RF00719; mir-326

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR326 is a microRNA implicated in the regulation of immune responses and has been associated with various diseases [PMC9237370]. In the context of HIV-1 infection, MIR326 is one of the microRNAs that have been shown to reduce HIV-1 replication, suggesting a potential role in antiviral defense mechanisms [PMC9237370]. Additionally, MIR326 has been linked to progression-free survival (PFS) in patients, indicating its potential as a prognostic biomarker [PMC7073212]. The involvement of MIR326 in both the suppression of HIV-1 replication and its correlation with PFS underscores its significance in disease progression and patient outcomes [PMC7073212; PMC9237370]..

Literature search
75 open access papers mention hsa-mir-326
(392 sentences)

Sequence

1560 reads, 7 reads per million, 90 experiments
cucaucugucuguugggcuggaggcagggccuuugugaaggcggguggugcucagaucgCCUCUGGGCCCUUCCUCCAGccccgaggcggauuca
...((((((((...((((((((((.(((((((......((((((.((.....))..))))))..))))))).))))))))))..))))))))...

Structure
cuc        guu          c       uuguga      -g  g 
   aucugucu   gggcuggagg agggccu      aggcgg  ug u
   ||||||||   |||||||||| |||||||      ||||||  || g
   uaggcgga   cccGACCUCC UCCCGGG      UCCgcu  ac c
acu        -gc          U       ----UC      ag  u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. miR-326 cloned in [3] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chr11: 75335092-75335186 [-]

Disease association
hsa-mir-326 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-326

Accession MIMAT0000756
Description Homo sapiens hsa-miR-326 mature miRNA
Sequence 60 - CCUCUGGGCCCUUCCUCCAG - 79
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365