MIR326 is a microRNA that has been associated with progression-free survival (PFS) in certain cases, such as miR155, miR210, and miR130a [PMC7073212]. It has been found that miR29a targets HIV-1 US vRNA and leads to translational repression, while miR133b, miR138-5, MIR326, miR149-5p, and miR92a-3p have been shown to reduce HIV-1 replication [PMC9237370]. Additionally, the expression of MIR326 negatively correlates with HIV-1 infection [PMC9237370].
cuc guu c uuguga -g g aucugucu gggcuggagg agggccu aggcgg ug u |||||||| |||||||||| ||||||| |||||| || g uaggcgga cccGACCUCC UCCCGGG UCCgcu ac c acu -gc U ----UC ag u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000756 |
Description | Homo sapiens hsa-miR-326 mature miRNA |
Sequence | 60 - CCUCUGGGCCCUUCCUCCAG - 79 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|