MIR345 is a methylation-sensitive microRNA (miRNA) that is involved in cell proliferation and invasion in colorectal cancer [PMC3383700]. It has been found to be differentially expressed in pancreatic cancer tissues, suggesting its potential as a therapeutic target for pancreatic malignancy [PMC7457762]. MIR345 has also been identified as one of the miRNAs expressed at low levels in tumor tissues or cells [PMC7797122]. Additionally, its expression has been reported to reduce dose-dependently in the model of endothelial injury induced by oxLDL [PMC9199460]. The aberrant expression of MIR345, along with other miRNAs such as let-7, miR-34, and miR-342, is regulated by DNA methylation and is associated with the development of colorectal cancer [PMC9141994] [PMC8910953]. In the context of gastric cancer (GC), MIR345 has been identified as one of the factors related to survival [PMC5856436]. Furthermore, MIR345 has been identified as a metastasis-suppressive gene in colorectal cancer along with other protein-coding genes and microRNAs [PMC8484294]. In leukoplakia and invasive oral squamous cell carcinoma (OSCC), overexpression of MIR345 has been associated with increases in lesion severity during progression, suggesting its potential role in malignant transformation [PMC3292026] [PMC5596676]. Overall, MIR345 is a methylation-sensitive miRNA that plays important roles in various cancers and may serve as a potential therapeutic target or prognostic marker.
---------acc u G U A C gau caaaccc aggucu C GACUCCU GU CAGGGCUCgu g ||||||| |||||| | ||||||| || |||||||||| guuuggg uccgGA G CUGGGGA CA GUCCCGggug g cgacagcuauaa - G U G A guc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000772 |
Description | Homo sapiens hsa-miR-345-5p mature miRNA |
Sequence | 18 - GCUGACUCCUAGUCCAGGGCUC - 39 |
Evidence |
experimental
cloned [3-4], Northern [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0022698 |
Description | Homo sapiens hsa-miR-345-3p mature miRNA |
Sequence | 54 - GCCCUGAACGAGGGGUCUGGAG - 75 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|