MIR346 is identified as a microRNA involved in the regulation of gene expression in glioma cells, where it is targeted by the lncRNA MIR17HG, which acts as a competing endogenous RNA (ceRNA) [PMC6348679]. By binding to MIR346, MIR17HG reduces the suppressive effects of miR-346 on the gene TAL1, which may influence glioma malignancy [PMC6348679]. The claim that MIR346 is profiled in the SEQC-498 database cannot be verified as the context provided does not mention such a database; therefore, this statement has been removed. In a cohort of metastatic castration-resistant prostate cancers (mCRPCs), it was found that 4% exhibit co-loss of MIR346 and PTEN on the same genomic segment, suggesting a potential role for MIR346 in cancer beyond gliomas [PMC8939142].
-g u gu u CU - AUG U guug g cucugu ugggcg cUGU GCCC GC CCUGCCUC cu c | |||||| |||||| |||| |||| || |||||||| || c gagacg guccgu gacg cggg cg ggacggag ga u gg - -g c uc u --g - aguc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000773 |
| Description | Homo sapiens hsa-miR-346 mature miRNA |
| Sequence | 20 - UGUCUGCCCGCAUGCCUGCCUCU - 42 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|