MIR346 is a microRNA that has been found to play a role in glioma cells. It has been shown that MIR17HG acts as a competing endogenous RNA (ceRNA) by binding to MIR346 and miR-425-5p, which helps to counteract the negative regulatory effect of these microRNAs on the TAL1 gene, thereby influencing the malignant behavior of glioma cells [PMC6348679]. In addition to MIR346, three other genes (C10Orf57, RGR, and SFTPD) were identified in the E-MTAB-1781 dataset, while 34 other genes were found in the SEQC-498 database [PMC10093755]. Furthermore, in a study involving 48 metastatic castration-resistant prostate cancers (mCRPCs), it was observed that 4% of cases had a deep deletion involving both MIR346 and PTEN genes, compared to 22% of cases with deep deletion of PTEN alone [PMC8939142]. These findings highlight the importance of MIR346 in various biological processes and its potential role as a biomarker or therapeutic target.
-g u gu u CU - AUG U guug g cucugu ugggcg cUGU GCCC GC CCUGCCUC cu c | |||||| |||||| |||| |||| || |||||||| || c gagacg guccgu gacg cggg cg ggacggag ga u gg - -g c uc u --g - aguc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000773 |
Description | Homo sapiens hsa-miR-346 mature miRNA |
Sequence | 20 - UGUCUGCCCGCAUGCCUGCCUCU - 42 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|