miRBase entry: hsa-mir-346

Stem-loop hsa-mir-346


Accession
MI0000826
Symbol
HGNC: MIR346
Description
Homo sapiens hsa-mir-346 precursor miRNA mir-346
Gene
family?
RF00758; mir-346

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR346 is a microRNA that has been found to play a role in glioma cells. It has been shown that MIR17HG acts as a competing endogenous RNA (ceRNA) by binding to MIR346 and miR-425-5p, which helps to counteract the negative regulatory effect of these microRNAs on the TAL1 gene, thereby influencing the malignant behavior of glioma cells [PMC6348679]. In addition to MIR346, three other genes (C10Orf57, RGR, and SFTPD) were identified in the E-MTAB-1781 dataset, while 34 other genes were found in the SEQC-498 database [PMC10093755]. Furthermore, in a study involving 48 metastatic castration-resistant prostate cancers (mCRPCs), it was observed that 4% of cases had a deep deletion involving both MIR346 and PTEN genes, compared to 22% of cases with deep deletion of PTEN alone [PMC8939142]. These findings highlight the importance of MIR346 in various biological processes and its potential role as a biomarker or therapeutic target.

Literature search
38 open access papers mention hsa-mir-346
(440 sentences)

Sequence

536 reads, 40 reads per million, 60 experiments
ggucucuguguugggcgucUGUCUGCCCGCAUGCCUGCCUCUcuguugcucugaaggaggcaggggcugggccugcagcugccugggcagagcgg
.(.((((((..((((((.((((..((((((...((((((((.((..........)))))))))).)).))))..)))).)))))).)))))))..

Structure
-g u      gu      u    CU    -  AUG        U  guug 
  g cucugu  ugggcg cUGU  GCCC GC   CCUGCCUC cu    c
  | ||||||  |||||| ||||  |||| ||   |||||||| ||     
  c gagacg  guccgu gacg  cggg cg   ggacggag ga    u
gg -      -g      c    uc    u  --g        -  aguc 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1]. The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human.

Genome context
chr10: 86264694-86264788 [-]

Disease association
hsa-mir-346 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-346

Accession MIMAT0000773
Description Homo sapiens hsa-miR-346 mature miRNA
Sequence 20 - UGUCUGCCCGCAUGCCUGCCUCU - 42
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365