miRBase entry: rno-mir-9a-3

Stem-loop rno-mir-9a-3


Accession
MI0000839
Description
Rattus norvegicus rno-mir-9a-3 precursor miRNA

Literature search
78 open access papers mention rno-mir-9a-3
(761 sentences)

Sequence

5579712 reads, 224306 reads per million, 493 experiments
ggaggcccguuucucUCUUUGGUUAUCUAGCUGUAUGAgugccacagagccgucAUAAAGCUAGAUAACCGAAAGUagaaaugacucuaa
((((...(((((((((.(((((((((((((((.(((((..((......))..))))).))))))))))))))))).))))))).))))..

Structure
--    gcc       -  C               G     gu  ca 
  ggag   cguuucu cU UUUGGUUAUCUAGCU UAUGA  gc  c
  ||||   ||||||| || ||||||||||||||| |||||  ||   
  ucuc   guaaaga GA AAGCCAAUAGAUCGA AUAcu  cg  a
aa    --a       U  -               A     gc  ag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 141229353-141229442 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-9a-3
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-9a-5p

Accession MIMAT0000781
Description Rattus norvegicus rno-miR-9a-5p mature miRNA
Sequence 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38
Evidence experimental
cloned [1-4], SOLiD [5]

Mature rno-miR-9a-3p

Accession MIMAT0004708
Description Rattus norvegicus rno-miR-9a-3p mature miRNA
Sequence 55 - AUAAAGCUAGAUAACCGAAAGU - 76
Evidence experimental
cloned [3], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714