miRBase entry: rno-mir-27a

Stem-loop rno-mir-27a


Accession
MI0000860
Description
Rattus norvegicus rno-mir-27a precursor miRNA
Gene family
MIPF0000036; mir-27

Literature search
56 open access papers mention rno-mir-27a
(599 sentences)

Sequence

956928 reads, 870 reads per million, 496 experiments
uggccuguggagcAGGGCUUAGCUGCUUGUGAGCAaggucuacagcaaagucgugUUCACAGUGGCUAAGUUCCGCccccuggaccc
.((((.(.((.((.(((((((((((((.(((((((.((.((.......)))).)))))))))))))))))))).)).))).)).)).

Structure
u  -  u u  a  A             U       a  u  ac 
 gg cc g gg gc GGGCUUAGCUGCU GUGAGCA gg cu  a
 || || | || || ||||||||||||| ||||||| || ||  g
 cc gg c cc CG CUUGAAUCGGUGA CACUUgu cu ga  c
c  a  u -  c  C             -       g  -  aa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 25318736-25318822 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from rno-mir-27a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-27a-5p

Accession MIMAT0004715
Description Rattus norvegicus rno-miR-27a-5p mature miRNA
Sequence 14 - AGGGCUUAGCUGCUUGUGAGCA - 35
Evidence experimental
cloned [2], SOLiD [4]

Mature rno-miR-27a-3p

Accession MIMAT0000799
Description Rattus norvegicus rno-miR-27a-3p mature miRNA
Sequence 56 - UUCACAGUGGCUAAGUUCCGC - 76
Evidence experimental
cloned [1-3], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714