Stem-loop rno-mir-125b-2

Accession

MI0000897

Description

Rattus norvegicus rno-mir-125b-2 precursor miRNA

Gene family

MIPF0000033; mir-10

Literature search

74 open access papers mention rno-mir-125b-2
(591 sentences)

Sequence

2370215 reads, 3253 reads per million, 496 experiments

accagacuuuuccuagUCCCUGAGACCCUAACUUGUGAgguauuuuaguaacaucACAAGUCAGGCUCUUGGGACCUaggcggagagg
.((...((((.(((((((((.((((.(((.((((((((.((.........)).)))))))).))).)))))))).))))).)))).))

Structure

a  aga    u     -    U    C   A        g  auu 
 cc   cuuu ccuag UCCC GAGA CCU ACUUGUGA gu   u
 ||   |||| ||||| |||| |||| ||| |||||||| ||   u
 gg   gagg ggaUC AGGG UUCU GGA UGAACAcu ca   a
-  --a    c     C    -    C   C        a  aug 

Annotation confidence High

Genome context

chr11: 16097346-16097433 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from rno-mir-125b-2

Mature rno-miR-125b-5p

• Accession: MIMAT0000830
• Description: Rattus norvegicus rno-miR-125b-5p mature miRNA
• Sequence: 17 - UCCCUGAGACCCUAACUUGUGA - 38
• Evidence: experimental ; cloned [1-5], Northern [1,3], SOLiD [6]

Mature rno-miR-125b-2-3p

• Accession: MIMAT0026467
• Description: Rattus norvegicus rno-miR-125b-2-3p mature miRNA
• Sequence: 56 - ACAAGUCAGGCUCUUGGGACCU - 77
• Evidence: experimental ; cloned [4], SOLiD [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68


6. PubMed ID: 17805466
   Cloning and identification of novel microRNAs from rat hippocampus
   "He X, Zhang Q, Liu Y, Pan X"
   "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714