miRBase entry: rno-mir-132

Stem-loop rno-mir-132


Accession
MI0000905
Description
Rattus norvegicus rno-mir-132 precursor miRNA

Literature search
82 open access papers mention rno-mir-132
(583 sentences)

Sequence

366114 reads, 1417 reads per million, 474 experiments
ccgcccccgcgucuccagggcaACCGUGGCUUUCGAUUGUUACUgugggaaccggaggUAACAGUCUACAGCCAUGGUCGccccgcagcacgcccacgcuc
..((....((((((.(.((((.(((((((((...((((((((((.(((...)))..))))))))))...))))))))).)))).).)).))))....))..

Structure
cc  cccc    -  c a    a         UUC          -g   g 
  gc    gcgu cu c gggc ACCGUGGCU   GAUUGUUACU  ugg  
  ||    |||| || | |||| |||||||||   ||||||||||  ||| a
  cg    cgca ga g cccG UGGUACCGA   CUGACAAUgg  gcc  
cu  cacc    c  c c    C         CAU          ag   a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 62014995-62015095 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-132
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-132-5p

Accession MIMAT0017123
Description Rattus norvegicus rno-miR-132-5p mature miRNA
Sequence 23 - ACCGUGGCUUUCGAUUGUUACU - 44
Evidence experimental
SOLiD [5]

Mature rno-miR-132-3p

Accession MIMAT0000838
Description Rattus norvegicus rno-miR-132-3p mature miRNA
Sequence 59 - UAACAGUCUACAGCCAUGGUCG - 80
Evidence experimental
cloned [1-4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714