miRBase entry: osa-MIR399f

Stem-loop osa-MIR399f


Accession
MI0001058
Description
Oryza sativa osa-MIR399f precursor miRNA

Literature search
58 open access papers mention osa-MIR399f
(223 sentences)

Sequence


ugguggauuaccgggccaugucuccuugggcagaggugaucagauugcacacuucacuucaaccucuugcucuagcuuguucucucUGCCAAAGGAGAUUUGCCCAGcaauccacau
..(((((((.(.((((...((((((((.((((((((.(((.((...(((..................))).....)).))).)))))))).))))))))..)))).).)))))))..

Structure
ug       a c    cau        g        u   c  --auu   cacuucac 
  guggauu c gggc   gucuccuu ggcagagg gau ag     gca        u
  ||||||| | ||||   |||||||| |||||||| ||| ||     |||         
  caccuaa G CCCG   UAGAGGAA CCGUcucu uug uc     cgu        u
ua       c A    -UU        A        c   u  gaucu   ucuccaac 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Chr6: 20888631-20888747 [-]

Database links

Mature osa-miR399f

Accession MIMAT0000989
Description Oryza sativa osa-miR399f mature miRNA
Sequence 87 - UGCCAAAGGAGAUUUGCCCAG - 107
Evidence not_experimental

References

  1. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799