Stem-loop ath-MIR156h

Accession

MI0001083

Description

Arabidopsis thaliana ath-MIR156h precursor miRNA

Literature search

80 open access papers mention ath-MIR156h
(799 sentences)

Sequence

augaaaaauguUGACAGAAGAAAGAGAGCACaaccugggauuagcaaaaagauaguuuugcccuugucgggagugugcucucuuuccuucugccaccaucauugcg
.......(((.((.((((((((((((((((((.(((((.(...((((((......))))))...).)))))..)))))))))))).)))))).)).))).......

Structure

augaaaa   u  A      -            -a     g uua      ag 
       aug UG CAGAAG AAAGAGAGCACa  ccugg a   gcaaaa  a
       ||| || |||||| ||||||||||||  ||||| |   ||||||   
       uac ac gucuuc uuucucucgugu  gggcu u   cguuuu  u
gcguuac   c  c      c            ga     g ucc      ga 

Annotation confidence Not enough data

Comments

This sequence is a predicted paralogue of the previously identified miR156 family [1], subsequently verified in [2]. It is predicted to target mRNAs coding for Squamosa-promoter Binding Protein (SBP)-like transcription factors.

Genome context

chr5: 22597012-22597117 [-]

Mature ath-miR156h

• Accession: MIMAT0001013
• Description: Arabidopsis thaliana ath-miR156h mature miRNA
• Sequence: 12 - UGACAGAAGAAAGAGAGCAC - 31
• Evidence: experimental ; 454 [2], Illumina [3]

References

1. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


2. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


3. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799