miRBase entry: mmu-mir-384

Stem-loop mmu-mir-384


Accession
MI0001146
Symbol
MGI: Mir384
Description
Mus musculus mmu-mir-384 precursor miRNA mir-384
Gene
family?
RF00841; mir-384

Literature search
15 open access papers mention mmu-mir-384
(153 sentences)

Sequence

12843 reads, 120 reads per million, 34 experiments
uguuaaaucaggaauUGUAAACAAUUCCUAGGCAAUGUguauaauguugguaagucAUUCCUAGAAAUUGUUCACAAUgccuguaaca
(((((...((((.(((((.(((((((.(((((.((((..................))))))))).))))))).))))).)))))))))

Structure
     aau    a     A       C     C    Uguauaau 
uguua   cagg auUGU AACAAUU CUAGG AAUG        g
|||||   |||| ||||| ||||||| ||||| ||||         
acaau   gucc UAACA UUGUUAA GAUCC UUAc        u
     ---    g     C       A     -    ugaauggu 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 105344282-105344369 [-]

Database links

Mature mmu-miR-384-5p

Accession MIMAT0004745
Description Mus musculus mmu-miR-384-5p mature miRNA
Sequence 16 - UGUAAACAAUUCCUAGGCAAUGU - 38
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-384-3p

Accession MIMAT0001076
Description Mus musculus mmu-miR-384-3p mature miRNA
Sequence 57 - AUUCCUAGAAAUUGUUCACAAU - 78
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009