miRBase entry: osa-MIR393b

Stem-loop osa-MIR393b


Accession
MI0001148
Description
Oryza sativa osa-MIR393b precursor miRNA

Literature search
51 open access papers mention osa-MIR393b
(127 sentences)

Sequence

290 reads, 202 reads per million, 2 experiments
ucggccugaggaaacuaguggaggacUCCAAAGGGAUCGCAUUGAUCUggcuagcuaucucgaucgaucgccucaucgaucgacgacgacgugcgugaucgaUCAGUGCAAUCCCUUUGGAAUuuuccucuu
................((.((((((.(((((((((((.(((((((((.(((..((..(((((.(((((((......)))))))))).))...))..).))))))))))).))))))))))).)))))).)).

Structure
ucggccugaggaaacu  u      c           C         U  - ua  -ua  -   a       cc 
                ag ggagga UCCAAAGGGAU GCAUUGAUC gg c  gc   uc ucg ucgaucg  u
                || |||||| ||||||||||| ||||||||| || |  ||   || ||| |||||||   
                uc ccuuuU AGGUUUCCCUA CGUGACUag cu g  cg   ag agc agcuagc  c
---------------u  u      A           A         -  a ug  ugc  c   -       ua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
Chr4: 34931876-34932007 [-]

Database links

Mature osa-miR393b-5p

Accession MIMAT0001078
Description Oryza sativa osa-miR393b-5p mature miRNA
Sequence 27 - UCCAAAGGGAUCGCAUUGAUCU - 48
Evidence experimental
Illumina [2]
Database links

Mature osa-miR393b-3p

Accession MIMAT0015123
Description Oryza sativa osa-miR393b-3p mature miRNA
Sequence 103 - UCAGUGCAAUCCCUUUGGAAU - 123
Evidence experimental
Illumina [2]
Database links

References

  1. PubMed ID: 15258262
    Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
    "Sunkar R, Zhu JK"
    "Plant Cell (2004) 16:2001-2019

  2. PubMed ID: 19903869
    Rice MicroRNA effector complexes and targets
    "Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y"
    "Plant Cell (2009) 21:3421-3435