miRBase entry: mmu-mir-411

Stem-loop mmu-mir-411


Accession
MI0001163
Symbol
MGI: Mir411
Description
Mus musculus mmu-mir-411 precursor miRNA mir-379
Gene
family?
RF04292; mir-379

Literature search
22 open access papers mention mmu-mir-411
(69 sentences)

Sequence

876914 reads, 4200 reads per million, 99 experiments
ugguacuuggagagaUAGUAGACCGUAUAGCGUACGcuuuaucugugacgUAUGUAACACGGUCCACUAACCcucaguauca
(((((((..(((.(.((((.((((((...((((((((.........).)))))))...)))))).)))).).))))))))))

Structure
       ug   a a    A      AUA       - uuu 
ugguacu  gag g UAGU GACCGU   GCGUACG c   a
|||||||  ||| | |||| ||||||   ||||||| |   u
acuauga  cuc C AUCA CUGGCA   UGUAUgc g   c
       --   C A    C      CAA       a ugu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the mature sequence from the 3' arm of this hairpin [1]. Landgraf et al. later showed that the 5' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr12: 109710175-109710256 [+]
Clustered miRNAs
15 other miRNAs are < 10 kb from mmu-mir-411
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-411-5p

Accession MIMAT0004747
Description Mus musculus mmu-miR-411-5p mature miRNA
Sequence 16 - UAGUAGACCGUAUAGCGUACG - 36
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-411-3p

Accession MIMAT0001093
Description Mus musculus mmu-miR-411-3p mature miRNA
Sequence 51 - UAUGUAACACGGUCCACUAACC - 72
Evidence experimental
PCR [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748