Accession
MI0001174
Description
Gallus gallus
gga-let-7c precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Gga-let-7c is a microRNA (miRNA) that is prominently expressed in chicken breast muscle libraries, indicating its potential regulatory importance in muscle tissue [PMC4519947]. This miRNA, a member of the let-7 family, was identified with a significant number of isoforms, with 26 different isoforms of gga-let-7c being reported [PMC4519947]. Among these isoforms, the most abundant ones are consistent with the sequences found in miRBase, suggesting that these are the canonical forms of gga-let-7c [PMC4519947]. The let-7 family overall is abundantly expressed in breast muscle libraries and gga-let-7c is one of the five let-7 members that rank among the top 20 most abundant miRNAs in this tissue [PMC4519947]. In addition to its expression in muscle tissue, gga-let-7c also shows differential expression patterns during viral infections and reproductive development; it was differentially expressed in chicken lungs and trachea infected with avian influenza virus [PMC5389138] and was found to be down-regulated in chicken ovaries compared to testes [PMC3526641].
Literature search
47 open access papers mention gga-let-7c
(330 sentences)
(330 sentences)
Sequence
1074972
reads,
12632
reads per million, 5 experiments
gcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaaCUGUACAACCUUCUAGCUUUCCuuggagc
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))
Structure
a uU G U ua g ua c gc uccggg GAG UAG AGGUUGUAUGGUU ga u ca || |||||| ||| ||| ||||||||||||| || | || c cg agguuC UUC AUC UCCAACAUGUCaa uu a gu - CU G U -- g gg c
Annotation confidence
High
Do you think this miRNA is real?
Genome context
chr1: 99018794-99018877 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from gga-let-7c
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature gga-let-7c-5p
| Accession | MIMAT0001104 |
| Description | Gallus gallus gga-let-7c-5p mature miRNA |
| Sequence | 11 - UGAGGUAGUAGGUUGUAUGGUU - 32 |
| Evidence |
experimental
Illumina [2] |
| Database links |
|
| Predicted targets |
|
Mature gga-let-7c-3p
| Accession | MIMAT0026492 |
| Description | Gallus gallus gga-let-7c-3p mature miRNA |
| Sequence | 56 - CUGUACAACCUUCUAGCUUUCC - 77 |
| Evidence |
experimental
Illumina [2] |
References
|
