Gga-let-7c is a microRNA (miRNA) that is dominantly expressed in chicken breast muscle libraries [PMC3700833]. It has 26 different isoforms, making it one of the most highly expressed miRNAs [PMC4519947]. Some of the isoforms of gga-let-7c are identical to the reference in miRBase [PMC4519947]. The let-7 family, including gga-let-7c, is abundantly expressed in chicken breast muscle libraries and is among the top 20 most abundant miRNAs [PMC4519947]. In other studies, differentially expressed miRNAs were found in various contexts such as chicken lungs infected with avian influenza virus, A549 cells infected with influenza A virus, mice infected with recombinant influenza A H1N1 virus strains, cynomolgus macaques infected with highly pathogenic H5N1 avian virus, and chicken lung and trachea infected with avian influenza virus [PMC5389138]. In the ovary compared to the testis, gga-let-7a, gga-let-7f and gga-let-7c were down-regulated while gga-miR26a, gga-miR148a and gga-miR451 were up-regulated [PMC3526641].
a uU G U ua g ua c gc uccggg GAG UAG AGGUUGUAUGGUU ga u ca || |||||| ||| ||| ||||||||||||| || | || c cg agguuC UUC AUC UCCAACAUGUCaa uu a gu - CU G U -- g gg c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0001104 |
Description | Gallus gallus gga-let-7c-5p mature miRNA |
Sequence | 11 - UGAGGUAGUAGGUUGUAUGGUU - 32 |
Evidence |
experimental
Illumina [2] |
Database links | |
Predicted targets |
Accession | MIMAT0026492 |
Description | Gallus gallus gga-let-7c-3p mature miRNA |
Sequence | 56 - CUGUACAACCUUCUAGCUUUCC - 77 |
Evidence |
experimental
Illumina [2] |
|