gga-mir-203 is a microRNA that has been identified as significantly differentially expressed across various chicken groups, with notable expression changes particularly in the CM group compared to the CS group [PMC5203650]. This miRNA has been quantified using specific primer sets in a real-time detection system, highlighting its relevance in gene expression studies [PMC4123083]. The sequence of gga-mir-203 has been cloned for experimental purposes to facilitate the study of its interactions with target genes [PMC5964199]. One such target is TP63 mRNA, which is involved in myogenic differentiation and has been shown to be downregulated upon transfection with a gga-mir-203 mimic in chicken primary myoblasts [PMC6157316]. The direct interaction between gga-mir-203 and TP63 mRNA was confirmed through a dual-luciferase reporter gene assay, which supports the prediction that TP63 is a direct target of gga-mir-203 [PMC6157316]. This interaction was further corroborated by conservation analysis across vertebrates and by using predictive software [PMC6157316]. Functional studies involving co-transfection of gga-mir-203 mimic and TP63 3′UTR reporter constructs into chicken cells have provided insights into the role of this miRNA as a negative regulator of myogenic differentiation, which aligns with the known functions of TP63 in muscle differentiation processes [PMC6157316]. Additionally, gga-mir-203 was one of only two miRNAs found to be significantly differentially abundant across both condition and line comparisons in chickens, indicating its potential importance across different genetic backgrounds or environmental conditions [PMC4256448].
----- -a c gc u g a cuc
cuc gccuc uuggu agugguucu aaca uuca caguu u
||| ||||| ||||| ||||||||| |||| |||| ||||| a
ggg cggag gacca UCACCAGGA UUGU AAGU Guuaa u
gcuac cc c GU U A - uac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0001146 |
| Description | Gallus gallus gga-miR-203a mature miRNA |
| Sequence | 56 - GUGAAAUGUUUAGGACCACUUG - 77 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|