miRBase entry: mmu-mir-431

Stem-loop mmu-mir-431


Accession
MI0001524
Symbol
MGI: Mir431
Description
Mus musculus mmu-mir-431 precursor miRNA
Gene family
MIPF0000142; mir-431

Literature search
21 open access papers mention mmu-mir-431
(173 sentences)

Sequence

85954 reads, 1241 reads per million, 67 experiments
cguccugcgaggUGUCUUGCAGGCCGUCAUGCAggccacacugacgguaacguugCAGGUCGUCUUGCAGGGCUUCUcgcaagacgacauc
((((.(((((((.((((((((((.((.(.((((((((........)))....))))).).)).)))))))))).))))))).)))).....

Structure
-----    c       U          C  U A     ----   aca 
     cguc ugcgagg GUCUUGCAGG CG C UGCAg    gcc   c
     |||| ||||||| |||||||||| || | |||||    |||    
     gcag acgcUCU CGGGACGUUC GC G ACguu    ugg   u
cuaca    a       U          U  U G     gcaa   cag 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr12: 109590447-109590537 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from mmu-mir-431
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-431-5p

Accession MIMAT0001418
Description Mus musculus mmu-miR-431-5p mature miRNA
Sequence 13 - UGUCUUGCAGGCCGUCAUGCA - 33
Evidence experimental
PCR [1], cloned [2-3], insitu [2], Northern [2], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-431-3p

Accession MIMAT0004753
Description Mus musculus mmu-miR-431-3p mature miRNA
Sequence 56 - CAGGUCGUCUUGCAGGGCUUCU - 77
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15854907
    RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus
    "Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C"
    "Curr Biol (2005) 15:743-749

  5. PubMed ID: 16566924
    Identification of new central nervous system specific mouse microRNAs
    "Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T"
    "FEBS Lett (2006) 580:2195-2200