MIR449A is identified as an endogenous regulator of MET-mediated epithelial-mesenchymal transition (EMT), alongside other regulators such as miR-148a and SENP1 [PMC5643285]. This small RNA is also implicated in the cellular response to hypoxia/reoxygenation (H/R) injury in H9C2 cells, with studies suggesting a functional link between MIR449A and the nuclear receptor subfamily 4 group A member 2 (NR4A2) [PMC8406901]. Additionally, MIR449A is listed among the genes encoding small RNAs in Emca3, which also includes miR449c and miR582 [PMC4132170].
-c c - U u aa g ugugugugaugag UGGCAGU GUAU GUUAGCUGGU g uau u ||||||||||||| ||||||| |||| |||||||||| | ||| auauacguuauuc gucguca cgua caaucggcua c gua g ac u a - - -g a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001541 |
Description | Homo sapiens hsa-miR-449a mature miRNA |
Sequence | 16 - UGGCAGUGUAUUGUUAGCUGGU - 37 |
Evidence |
experimental
cloned [1-2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|