WARNING: This summary was generated by AI. MIR449A is identified as an endogenous regulator of MET-mediated epithelial-mesenchymal transition (EMT), alongside other regulators such as miR-148a and SENP1 [PMC5643285]. This small RNA is also implicated in the cellular response to hypoxia/reoxygenation (H/R) injury in H9C2 cells, with studies suggesting a functional link between MIR449A and the nuclear receptor subfamily 4 group A member 2 (NR4A2) [PMC8406901]. Additionally, MIR449A is listed among the genes encoding small RNAs in Emca3, which also includes miR449c and miR582 [PMC4132170].
-c c - U u aa g ugugugugaugag UGGCAGU GUAU GUUAGCUGGU g uau u ||||||||||||| ||||||| |||| |||||||||| | ||| auauacguuauuc gucguca cgua caaucggcua c gua g ac u a - - -g a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0001541 |
| Description | Homo sapiens hsa-miR-449a mature miRNA |
| Sequence | 16 - UGGCAGUGUAUUGUUAGCUGGU - 37 |
| Evidence |
experimental
cloned [1-2] |
| Database links |
|
| Predicted targets |
|
|