MIR449A is a type of endogenous regulator of MET-mediated EMT, along with miR-148a and SENP1 [PMC5643285]. It has been found to play a role in H9C2 cell damage caused by H/R, and its functional association with NR4A2 has been investigated [PMC8406901]. These findings highlight the importance of MIR449A in regulating cellular processes and its potential role in various biological contexts [PMC5643285][PMC8406901[PMC8406901].
-c c - U u aa g ugugugugaugag UGGCAGU GUAU GUUAGCUGGU g uau u ||||||||||||| ||||||| |||| |||||||||| | ||| auauacguuauuc gucguca cgua caaucggcua c gua g ac u a - - -g a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001541 |
Description | Homo sapiens hsa-miR-449a mature miRNA |
Sequence | 16 - UGGCAGUGUAUUGUUAGCUGGU - 37 |
Evidence |
experimental
cloned [1-2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|