Stem-loop hcmv-mir-UL22A

Accession

MI0001678

Description

Human cytomegalovirus hcmv-mir-UL22A precursor miRNA

Sequence

ccugucUAACUAGCCUUCCCGUGAGAguuuaugaacauguaucUCACCAGAAUGCUAGUUUGUAGagg
(((.((.(((((((.(((..((((((...............))))))..))).))))))).).).)))

Structure

   g - U       C   CC      guuuau 
ccu u c AACUAGC UUC  GUGAGA      g
||| | | ||||||| |||  ||||||      a
gga A G UUGAUCG AAG  CACUcu      a
   G U U       U   AC      auguac 

Annotation confidence Not enough data

Genome context

HEHCMVCG: 27642-27709 [+]

Disease association

hcmv-mir-UL22A is associated with one or more human diseases in the Human microRNA Disease Database

Mature hcmv-miR-UL22A-5p

• Accession: MIMAT0001574
• Description: Human cytomegalovirus hcmv-miR-UL22A-5p mature miRNA
• Sequence: 7 - UAACUAGCCUUCCCGUGAGA - 26
• Evidence: experimental ; cloned [1-3], Illumina [4-5]

Mature hcmv-miR-UL22A-3p

• Accession: MIMAT0001575
• Description: Human cytomegalovirus hcmv-miR-UL22A-3p mature miRNA
• Sequence: 44 - UCACCAGAAUGCUAGUUUGUAG - 65
• Evidence: experimental ; cloned [1-3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15782219
   Identification of microRNAs of the herpesvirus family
   "Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T"
   "Nat Methods (2005) 2:269-276


3. PubMed ID: 16207254
   Human cytomegalovirus expresses novel microRNAs during productive viral infection
   "Dunn W, Trang P, Zhong Q, Yang E, van Belle C, Liu F"
   "Cell Microbiol (2005) 7:1684-1695


4. PubMed ID: 22013051
   High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection
   "Stark TJ, Arnold JD, Spector DH, Yeo GW"
   "J Virol (2012) 86:226-235


5. PubMed ID: 22715351
   The microRNA Transcriptome of Human Cytomegalovirus (HCMV)
   "Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS"
   "Open Virol J (2012) 6:38-48