Stem-loop hcmv-mir-UL148D

Accession

MI0001681

Description

Human cytomegalovirus hcmv-mir-UL148D precursor miRNA

Sequence

agcaggugagguuggggcggacaacguguugcggauuguggcgagaacgUCGUCCUCCCCUUCUUCACCGcc
.((.(((((((..((((.((((.((((.((((........))))..)))).)))).))))..))))))))).

Structure

a  a       uu    c    a    -g    gga 
 gc ggugagg  gggg ggac acgu  uugc   u
 || |||||||  |||| |||| ||||  ||||    
 cG CCACUUC  CCCC CCUG Ugca  agcg   u
c  -       UU    U    C    ag    gug 

Annotation confidence Not enough data

Genome context

Unknown

Disease association

hcmv-mir-UL148D is associated with one or more human diseases in the Human microRNA Disease Database

Mature hcmv-miR-UL148D

• Accession: MIMAT0001578
• Description: Human cytomegalovirus hcmv-miR-UL148D mature miRNA
• Sequence: 50 - UCGUCCUCCCCUUCUUCACCG - 70
• Evidence: experimental ; cloned [1-2], Illumina [3-4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15782219
   Identification of microRNAs of the herpesvirus family
   "Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T"
   "Nat Methods (2005) 2:269-276


3. PubMed ID: 22013051
   High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection
   "Stark TJ, Arnold JD, Spector DH, Yeo GW"
   "J Virol (2012) 86:226-235


4. PubMed ID: 22715351
   The microRNA Transcriptome of Human Cytomegalovirus (HCMV)
   "Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS"
   "Open Virol J (2012) 6:38-48