miRBase entry: hcmv-mir-US33

Stem-loop hcmv-mir-US33


Accession
MI0001686
Description
Human cytomegalovirus hcmv-mir-US33 precursor miRNA


Sequence

cacgguuGAUUGUGCCCGGACCGUGGGCGcgacgaaacccaccgUCACGGUCCGAGCACAUCCAAacgug
((((..((..(((((.((((((((((.((.(..........))))))))))))).)))))..))..))))

Structure
    gu  AU     C          G  c acga 
cacg  uG  UGUGC CGGACCGUGG CG g    a
||||  ||  ||||| |||||||||| || |     
gugc  AC  ACACG GCCUGGCACU gc c    a
    aA  CU     A          -  - accc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
HEHCMVCG: 220470-220539 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from hcmv-mir-US33
Name Accession Chromosome Start End Strand Confidence




Disease association
hcmv-mir-US33 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hcmv-miR-US33-5p

Accession MIMAT0001584
Description Human cytomegalovirus hcmv-miR-US33-5p mature miRNA
Sequence 8 - GAUUGUGCCCGGACCGUGGGCG - 29
Evidence experimental
cloned [1-2], Illumina [3-4]

Mature hcmv-miR-US33-3p

Accession MIMAT0004756
Description Human cytomegalovirus hcmv-miR-US33-3p mature miRNA
Sequence 45 - UCACGGUCCGAGCACAUCCAA - 65
Evidence experimental
cloned [2], Illumina [3-4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15782219
    Identification of microRNAs of the herpesvirus family
    "Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T"
    "Nat Methods (2005) 2:269-276

  3. PubMed ID: 22013051
    High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection
    "Stark TJ, Arnold JD, Spector DH, Yeo GW"
    "J Virol (2012) 86:226-235

  4. PubMed ID: 22715351
    The microRNA Transcriptome of Human Cytomegalovirus (HCMV)
    "Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS"
    "Open Virol J (2012) 6:38-48