miRBase entry: hsa-mir-431

Stem-loop hsa-mir-431


Accession
MI0001721
Symbol
HGNC: MIR431
Description
Homo sapiens hsa-mir-431 precursor miRNA mir-431
Gene
family?
RF00718; mir-431

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR431 is a microRNA implicated in various biological processes and diseases, including sensorineural hearing loss (SNHL) and Alzheimer's disease (AD) [PMC5822652, PMC7564652].'>PMC7564652].. It is found in the DLK1-DIO3 locus at the 14q32 region and has been associated with mitochondrial degeneration in the inner ear and brain [PMC6202974, PMC6651274].. MIR431 has been shown to down-regulate Lhx8 expression, which is involved in neuronal differentiation [PMC6716883]. It also plays a role in the genetic expression associated with character traits by targeting a significant number of genes [PMC7515844]. In male mouse embryos, MIR431 expression was found to be more severely affected by the loss of Zfp57, a transcription factor involved in imprinting [PMC8895500]. Interestingly, MIR431's seed sequences have shown complementarity with hepatitis C virus RNA [PMC4495342], suggesting potential interactions with viral genomes. However, its downregulation has been observed in Alzheimer's disease patients' cortex tissue which may impact its protective role against Aβ toxicity and its modulation of pathways such as Wnt signaling [PMC7564652]. Additionally, MIR431 has been implicated in promoting metastasis of pancreatic neuroendocrine tumors by silencing tumor suppressor genes through Ras/Erk activation [PMC9218734], as well as being present in bone marrow stem cell-derived exosomes which are involved in axonal regeneration and remyelination processes [PMC9069372].

Literature search
88 open access papers mention hsa-mir-431
(186 sentences)

Sequence

23955 reads, 51.0 reads per million, 144 experiments
uccugcuuguccugcgaggUGUCUUGCAGGCCGUCAUGCAggccacacugacgguaacguugCAGGUCGUCUUGCAGGGCUUCUcgcaagacgacauccucaucaccaacgacg
...((.(((((.(((((((.((((((((((.((.(.((((((((........)))....))))).).)).)))))))))).))))))).)))))))..................

Structure
---------------ucc  c     c       U          C  U A     ----   aca 
                  ug uuguc ugcgagg GUCUUGCAGG CG C UGCAg    gcc   c
                  || ||||| ||||||| |||||||||| || | |||||    |||    
                  ac agcag acgcUCU CGGGACGUUC GC G ACguu    ugg   u
gcagcaaccacuacuccu  -     a       U          U  U G     gcaa   cag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 100881007-100881120 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from hsa-mir-431
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-431 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-431-5p

Accession MIMAT0001625
Description Homo sapiens hsa-miR-431-5p mature miRNA
Sequence 20 - UGUCUUGCAGGCCGUCAUGCA - 40
Evidence experimental
cloned [1-2]
Database links
Predicted targets

Mature hsa-miR-431-3p

Accession MIMAT0004757
Description Homo sapiens hsa-miR-431-3p mature miRNA
Sequence 63 - CAGGUCGUCUUGCAGGGCUUCU - 84
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706