miRBase entry: hsa-mir-433

Stem-loop hsa-mir-433


Accession
MI0001723
Symbol
HGNC: MIR433
Description
Homo sapiens hsa-mir-433 precursor miRNA mir-433
Gene
family?
RF00748; mir-433

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR433 is a microRNA implicated in various biological processes and diseases, with its expression levels influencing cellular and molecular pathways [PMC8235499]. Studies have shown that MIR433 down-regulation may act as a tumor suppressor, as seen in its involvement in the regulation of HDAC6 expression in multiple system atrophy [PMC8235499], [PMC9025474]. Expression levels of MIR433 have been categorized into low, intermediate, and high for statistical analyses [PMC3593171]. In cancer research, the interaction between CREB1 and the MIR433 promoter has been studied to understand its role in cancer cell proliferation [PMC6326693]. Additionally, MIR433 is part of a cluster of microRNAs at the 14q32 region that may be silenced by DNA hypermethylation in bladder tumor tissues [PMC4348104], and it has been found to be downregulated in various diseases including neurodegenerative disorders like Parkinson's disease [PMC4794499]. Furthermore, it has been suggested that MIR433 targets pathways such as RAP1a and MAPK signaling to inhibit cancer cell proliferation and plays a significant role in esophageal cancer and glioma [PMC9753082]. In traumatic brain injury patients with heterotopic ossification, decreased MIR433 expression leads to increased pro-inflammatory OPN/SPP1 protein accumulation which negatively affects bone healing [PMC9753082].

Literature search
75 open access papers mention hsa-mir-433
(576 sentences)

Sequence

5947 reads, 13 reads per million, 107 experiments
ccggggagaagUACGGUGAGCCUGUCAUUAUUCagagaggcuagauccucuguguugagaaggAUCAUGAUGGGCUCCUCGGUGUucuccagg
((..((((((...(((.(((((((((((.(((((.(((((......))))).))........))).))))))))))).)))...)))))).))

Structure
  gg      gUA   U           U   --------  g     cu 
cc  ggagaa   CGG GAGCCUGUCAU AUU        Ca agagg  a
||  ||||||   ||| ||||||||||| |||        || |||||   
gg  ccucuU   GCU CUCGGGUAGUA UAg        gu ucucc  g
  -a      GUG   C           C   gaagaguu  g     ua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 100881886-100881978 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from hsa-mir-433
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-433 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-433-3p

Accession MIMAT0001627
Description Homo sapiens hsa-miR-433-3p mature miRNA
Sequence 64 - AUCAUGAUGGGCUCCUCGGUGU - 85
Evidence experimental
cloned [1-2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-433-5p

Accession MIMAT0026554
Description Homo sapiens hsa-miR-433-5p mature miRNA
Sequence 12 - UACGGUGAGCCUGUCAUUAUUC - 33
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45