MIR433 is a microRNA that has been studied in various contexts. One study reported that down-regulation of MIR433 is associated with tumor suppression [PMC8235499]. In the brain with multiple system atrophy (MSA), MIR433 with reduced expression in the striatum is involved in the regulation of HDAC6 expression [PMC9025474]. MIR433 has been grouped by tertiles for statistical analysis [PMC3593171]. In a limited cohort of samples, differential signatures have shown upregulation of miR101, miR25, miR26b, miR335, and MIR433 [PMC7959144]. The binding between CREB1 and the MIR433 promoter has been studied using LV5-NC- and LV5-CREB1-infected cells [PMC6326693]. Several microRNAs, including MIR128, miR125, and MIR433, have been shown to regulate NMD factors [PMC6173407]. The expression of MIR433 has been observed in various diseases such as bladder tumor tissues and neurodegenerative diseases like Parkinson's disease and Huntington's disease [PMC4348104] [PMC4794499] [PMC9781427]. In esophageal cancer and glioma, MIR433 plays an important role [PMC9753082]. It has also been implicated in regulating OPN/SPP1 expression in bone tissues during tibial fracture healing [PMC9753082]. The expression of OPN/SPP1 is regulated by microRNAs including MIR433. Additionally, it has been shown that estrogen-related ERRĪ³ receptor may regulate transcription of the MIR433 gene from its locus. Furthermore, urinary excretion profile analysis showed an increase in fibrosis activators such as miR-21 or decrease in fibrosis suppressors like miR-29 or miR-200 in patients with renal fibrosis compared to healthy subjects [PMC6612965].
gg gUA U U -------- g cu cc ggagaa CGG GAGCCUGUCAU AUU Ca agagg a || |||||| ||| ||||||||||| ||| || ||||| gg ccucuU GCU CUCGGGUAGUA UAg gu ucucc g -a GUG C C gaagaguu g ua
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001627 |
Description | Homo sapiens hsa-miR-433-3p mature miRNA |
Sequence | 64 - AUCAUGAUGGGCUCCUCGGUGU - 85 |
Evidence |
experimental
cloned [1-2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026554 |
Description | Homo sapiens hsa-miR-433-5p mature miRNA |
Sequence | 12 - UACGGUGAGCCUGUCAUUAUUC - 33 |
Evidence |
experimental
Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|