MIR433 is a microRNA implicated in various biological processes and diseases, with its expression levels influencing cellular and molecular pathways [PMC8235499]. Studies have shown that MIR433 down-regulation may act as a tumor suppressor, as seen in its involvement in the regulation of HDAC6 expression in multiple system atrophy [PMC8235499], [PMC9025474]. Expression levels of MIR433 have been categorized into low, intermediate, and high for statistical analyses [PMC3593171]. In cancer research, the interaction between CREB1 and the MIR433 promoter has been studied to understand its role in cancer cell proliferation [PMC6326693]. Additionally, MIR433 is part of a cluster of microRNAs at the 14q32 region that may be silenced by DNA hypermethylation in bladder tumor tissues [PMC4348104], and it has been found to be downregulated in various diseases including neurodegenerative disorders like Parkinson's disease [PMC4794499]. Furthermore, it has been suggested that MIR433 targets pathways such as RAP1a and MAPK signaling to inhibit cancer cell proliferation and plays a significant role in esophageal cancer and glioma [PMC9753082]. In traumatic brain injury patients with heterotopic ossification, decreased MIR433 expression leads to increased pro-inflammatory OPN/SPP1 protein accumulation which negatively affects bone healing [PMC9753082].
gg gUA U U -------- g cu cc ggagaa CGG GAGCCUGUCAU AUU Ca agagg a || |||||| ||| ||||||||||| ||| || ||||| gg ccucuU GCU CUCGGGUAGUA UAg gu ucucc g -a GUG C C gaagaguu g ua
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001627 |
Description | Homo sapiens hsa-miR-433-3p mature miRNA |
Sequence | 64 - AUCAUGAUGGGCUCCUCGGUGU - 85 |
Evidence |
experimental
cloned [1-2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026554 |
Description | Homo sapiens hsa-miR-433-5p mature miRNA |
Sequence | 12 - UACGGUGAGCCUGUCAUUAUUC - 33 |
Evidence |
experimental
Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|