WARNING: This summary was generated by AI. Dre-mir-152 is a microRNA (miRNA) that has been identified as a key regulatory molecule in zebrafish, showing anticorrelation with genes from Cluster 3 and involvement in the G2M checkpoint [PMC7756072]. It is associated with one of three circular RNAs (circRNAs) in a downregulated competing endogenous RNA (ceRNA) subnetwork that may influence osteoclast differentiation [PMC9855694]. Specifically, dre-mir-152 targets the downregulated gene tspan5a during intermuscular bone (IB) growth and interacts with multiple mRNAs and long non-coding RNAs (lncRNAs), playing a pivotal role within ceRNA networks [PMC9855694]. The lncRNAs MSTRG.29519 and MSTRG.19062 may serve as molecular sponges for dre-mir-152, modulating its regulatory effects on tspan5a [PMC9855694]. Additionally, dre-mir-152 is one of the miRNAs with the highest expression levels in certain stages of IB development [PMC7891300].
cuguuca u c g a ca uugaa
cc ggcu aaguucugu au cacu gacu u
|| |||| ||||||||| || |||| |||| c
gg ccGG UUCAAGACA UA GUGA CUga a
------- c U G C -- uggug
| Accession | MIMAT0001847 |
| Description | Danio rerio dre-miR-152 mature miRNA |
| Sequence | 54 - UCAGUGCAUGACAGAACUUUGG - 75 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|