miRBase entry: dre-mir-454a

Stem-loop dre-mir-454a


Accession
MI0002074
Description
Danio rerio dre-mir-454a precursor miRNA mir-454
Gene
family?
RF00746; mir-454

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Dre-mir-454a is a candidate endogenous reference gene that was investigated for its suitability in a study [PMC8613261]. Normfinder software ranked dre-mir-454a as the third most stable gene among the preselected candidates [PMC8613261]. However, when expression data from MTZ treatments was considered, dre-mir-454a moved to the seventh position in the ranking [PMC8613261]. Additionally, when looking at three different strains, dre-mir-454a ranked fourth among the candidates [PMC8613261]. These rankings indicate that dre-mir-454a may not be as stable as other candidate reference genes in certain experimental conditions. The study aimed to identify suitable endogenous reference genes and investigated a total of nine candidates, including dre-mir-454a, for their suitability [PMC8613261]. The findings suggest that while dre-mir-454a may not be the most stable reference gene in all conditions, it could still be considered as a potential reference gene depending on the specific experimental context. Further research is needed to validate its stability and suitability in different experimental settings.

Literature search
1 open access papers mention dre-mir-454a
(1 sentences)

Sequence

2725 reads, 167 reads per million, 11 experiments
uugcaggucguuuaagaauuaauccuaauucuugggacccuaucaguauugccucugcuguccacuguguucagagUAGUGCAAUAUUGCUAAUAGGGuuuuagguuuuagguuguaccuucag
.((.((((...............(((((..((((((((((((((((((((((..(((((.....(((....)))))))).)))))))))...)))))))))))))..)))))....)))).)).

Structure
u  c    cguuuaagaauuaau     uu             ---         cu     gucca   u 
 ug aggu               ccuaa  cuugggacccuau   caguauugc  cugcu     cug g
 || ||||               |||||  |||||||||||||   |||||||||  |||||     |||  
 ac ucca               ggauu  ggauuuuGGGAUA   GUUAUAACG  GAUga     gac u
g  u    -----------uguu     uu             AUC         -U     -----   u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 33376818-33376941 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from dre-mir-454a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dre-miR-454a

Accession MIMAT0001877
Description Danio rerio dre-miR-454a mature miRNA
Sequence 77 - UAGUGCAAUAUUGCUAAUAGGG - 98
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 15937218
    The developmental miRNA profiles of zebrafish as determined by small RNA cloning
    "Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T"
    "Genes Dev (2005) 19:1288-1293