WARNING: This summary was generated by AI. Dre-mir-454a is a microRNA (miRNA) in zebrafish that has been evaluated for its stability as a reference gene in gene expression studies [PMC8613261]. According to the Normfinder software analysis, dre-mir-454a ranked as the third most stable miRNA with a stability value of 0.014, suggesting its potential utility as an endogenous control [PMC8613261]. However, when expression data from methimazole (MTZ) treatments were considered, dre-mir-454a's stability ranking dropped slightly to the seventh position with a value of 0.018 [PMC8613261]. Additionally, when comparing across three different zebrafish strains, dre-mir-454a's ranking was fourth in terms of stability with a value of 0.026 [PMC8613261]. The study investigated nine miRNAs including dre-mir-454a for their suitability as endogenous reference genes, indicating the importance of selecting stable reference genes for accurate normalization in gene expression analysis [PMC8613261].
u c cguuuaagaauuaau uu --- CU gucca u ug aggu ccuaa cuugggACCCUAU CAGUAUUGC CUGCU cug g || |||| ||||| ||||||||||||| ||||||||| ||||| ||| ac ucca ggauu ggauUUUGGGAUA GUUAUAACG GAUga gac u g u -----------uguu uu AUC -U ----- u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0052781 |
| Description | Danio rerio dre-miR-454a-5p mature miRNA |
| Sequence | 37 - ACCCUAUCAGUAUUGCCUCUGCU - 59 |
| Evidence |
experimental
cloned [1] |
| Accession | MIMAT0001877 |
| Description | Danio rerio dre-miR-454a-3p mature miRNA |
| Sequence | 77 - UAGUGCAAUAUUGCUAAUAGGGUUU - 101 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
|