Stem-loop hsa-mir-376b

Accession

MI0002466

Symbol

HGNC: MIR376B

Description

Homo sapiens hsa-mir-376b precursor miRNA mir-368

Gene
family

RF04291; mir-368

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR376B is a microRNA that regulates autophagy genes post-transcriptionally [PMC4502651]. In a recent review, more than 16 miRNAs were identified as regulators of autophagy genes, with MIR376B specifically acting on ATG4 and BECN1 [PMC4502651]. Another miRNA, MIR630, was found to act on ATG12 and UVRAG [PMC4502651]. To investigate the response of endogenous MIR376A and MIR376B levels during starvation stress, a kinetic analysis was performed using TaqMan qPCR [PMC3864973]. This analysis aimed to determine whether the levels of MIR376A and MIR376B were similarly increased during starvation stress [PMC3864973]. The study utilized TaqMan qPCR as a method to measure the expression levels of these microRNAs [PMC3864973]. The findings from this study could provide insights into the role of MIR376A and MIR376B in autophagy regulation under starvation conditions.

Literature search

52 open access papers mention hsa-mir-376b
(95 sentences)

Sequence

2925 reads, 139 reads per million, 83 experiments

caguccuucuuugguauuuaaaaCGUGGAUAUUCCUUCUAUGUUUacgugauuccugguuaAUCAUAGAGGAAAAUCCAUGUUuucaguaucaaaugcug
((((.....(((((((((.(((((((((((.(((((.(((((...((..........))....)))))))))).))))))))))).))))))))).))))

Structure

    ccuuc         u           A     U     -UUU  guga 
cagu     uuugguauu aaaaCGUGGAU UUCCU CUAUG    ac    u
||||     ||||||||| ||||||||||| ||||| |||||    ||     
gucg     aaacuauga uuUUGUACCUA AAGGA GAUAC    ug    u
    ----u         c           A     -     UAau  gucc 

Annotation confidence High

Comments

The mature miR-376b products have been shown to be modified by A to I edits [2].

Genome context

chr14: 101040436-101040535 [+]

Clustered miRNAs

15 other miRNAs are < 10 kb from hsa-mir-376b

Disease association

hsa-mir-376b is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-376b-3p

• Accession: MIMAT0002172
• Description: Homo sapiens hsa-miR-376b-3p mature miRNA
• Sequence: 62 - AUCAUAGAGGAAAAUCCAUGUU - 83
• Evidence: experimental ; cloned [3], SOLiD [4]

Mature hsa-miR-376b-5p

• Accession: MIMAT0022923
• Description: Homo sapiens hsa-miR-376b-5p mature miRNA
• Sequence: 24 - CGUGGAUAUUCCUUCUAUGUUU - 45
• Evidence: experimental ; SOLiD [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


3. PubMed ID: 17322061
   Redirection of silencing targets by adenosine-to-inosine editing of miRNAs
   "Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K"
   "Science (2007) 315:1137-1140


4. PubMed ID: 22282338
   Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
   "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
   "RNA (2012) 18:472-484