miRBase entry: hsa-mir-376b

Stem-loop hsa-mir-376b


Accession
MI0002466
Symbol
HGNC: MIR376B
Description
Homo sapiens hsa-mir-376b precursor miRNA mir-368
Gene
family?
RF04291; mir-368

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR376B is a microRNA that regulates autophagy genes post-transcriptionally [PMC4502651]. In a recent review, more than 16 miRNAs were identified as regulators of autophagy genes, with MIR376B specifically acting on ATG4 and BECN1 [PMC4502651]. Another miRNA, MIR630, was found to act on ATG12 and UVRAG [PMC4502651]. To investigate the response of endogenous MIR376A and MIR376B levels during starvation stress, a kinetic analysis was performed using TaqMan qPCR [PMC3864973]. This analysis aimed to determine whether the levels of MIR376A and MIR376B were similarly increased during starvation stress [PMC3864973]. The study utilized TaqMan qPCR as a method to measure the expression levels of these microRNAs [PMC3864973]. The findings from this study could provide insights into the role of MIR376A and MIR376B in autophagy regulation under starvation conditions.

Literature search
52 open access papers mention hsa-mir-376b
(95 sentences)

Sequence

2925 reads, 139 reads per million, 83 experiments
caguccuucuuugguauuuaaaaCGUGGAUAUUCCUUCUAUGUUUacgugauuccugguuaAUCAUAGAGGAAAAUCCAUGUUuucaguaucaaaugcug
((((.....(((((((((.(((((((((((.(((((.(((((...((..........))....)))))))))).))))))))))).))))))))).))))

Structure
    ccuuc         u           A     U     -UUU  guga 
cagu     uuugguauu aaaaCGUGGAU UUCCU CUAUG    ac    u
||||     ||||||||| ||||||||||| ||||| |||||    ||     
gucg     aaacuauga uuUUGUACCUA AAGGA GAUAC    ug    u
    ----u         c           A     -     UAau  gucc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature miR-376b products have been shown to be modified by A to I edits [2].

Genome context
chr14: 101040436-101040535 [+]
Clustered miRNAs
15 other miRNAs are < 10 kb from hsa-mir-376b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-376b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-376b-3p

Accession MIMAT0002172
Description Homo sapiens hsa-miR-376b-3p mature miRNA
Sequence 62 - AUCAUAGAGGAAAAUCCAUGUU - 83
Evidence experimental
cloned [3], SOLiD [4]
Database links
Predicted targets

Mature hsa-miR-376b-5p

Accession MIMAT0022923
Description Homo sapiens hsa-miR-376b-5p mature miRNA
Sequence 24 - CGUGGAUAUUCCUUCUAUGUUU - 45
Evidence experimental
SOLiD [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  3. PubMed ID: 17322061
    Redirection of silencing targets by adenosine-to-inosine editing of miRNAs
    "Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K"
    "Science (2007) 315:1137-1140

  4. PubMed ID: 22282338
    Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
    "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
    "RNA (2012) 18:472-484