MIR485 is a microRNA implicated in various biological processes and diseases, including cancer and viral infections. It has been engineered into a genetically modified adenovirus, ICOVIR15, to enhance viral propagation and antitumor activity in pancreatic cancer cells [PMC9171400]. MIR485 is known to target RIG-I mRNA for degradation, which can impair antiviral responses and facilitate the replication of viruses such as the influenza A virus [PMC6370596]. In muscle satellite cells, MIR485 expression is associated with cell survival as its downregulation is linked to the upregulation of genes promoting cell death [PMC6655560]. Contrary to previous claims, MIR485 expression does not show any change in the liver [PMC4482373]. Additionally, MIR485 may influence Wnt signaling pathways by negatively modulating non-canonical pathway components or by positively regulating the canonical pathway during macrophage infection by certain Mycobacterium tuberculosis strains [PMC5285348]. Elevated levels of MIR485 have been reported across different organs in treated groups compared to untreated groups [PMC4605239], indicating its potential role in response to treatments or infections. Furthermore, MIR485 can interact with other microRNAs and regulatory elements like ciRs7 which may influence its activity [PMC7512242].
u CU - A auuc acu ggagAGAGG GGCCGUG AUGA UUCg a ||| ||||||||| ||||||| |||| |||| u uga uuUCUCUCC UCGGCAC UACU Gagc c u UC A - gaaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002175 |
Description | Homo sapiens hsa-miR-485-5p mature miRNA |
Sequence | 9 - AGAGGCUGGCCGUGAUGAAUUC - 30 |
Evidence |
experimental
array-cloned [2], cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002176 |
Description | Homo sapiens hsa-miR-485-3p mature miRNA |
Sequence | 46 - GUCAUACACGGCUCUCCUCUCU - 67 |
Evidence |
experimental
cloned [1,3], array-cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|