MIR485 is a microRNA that has been studied in various contexts, including pancreatic cancer, viral infections, and muscle cell regulation. In pancreatic cancer cells, a genetically engineered adenovirus called ICOVIR15 was developed to code for MIR485 and miR99b, which enhanced viral propagation and increased antitumoral activity [PMC9171400]. MIR485 has been shown to target RIG-I mRNA for degradation, impairing the antiviral response and promoting replication of the influenza A virus [PMC6370596]. In muscle cells, MIR485 was found to be downregulated in satellite cells lacking ERα (scERαKO), which resulted in the upregulation of genes promoting cell death and downregulation of genes promoting cell survival [PMC6655560]. In various studies using different animal models, including dogs and mice, MIR485 was found to be differentially expressed in response to different conditions or treatments [PMC8376273] [PMC10001410] [PMC6122344] [PMC4482373]. Additionally, MIR485 has been implicated in modulating the canonical Wnt pathway by negatively regulating FZD4, RAC-1, PKC (88), SFRP1 levels and positively regulating STB1 levels [PMC5285348]. Furthermore, elevated levels of MIR485 were found in various organs after treatment compared to untreated groups [PMC4605239]. Finally, micro-RNA miR-485-5p transcript is known to be deregulated in Alzheimer's disease patients [PMC5546543].
u CU - A auuc acu ggagAGAGG GGCCGUG AUGA UUCg a ||| ||||||||| ||||||| |||| |||| u uga uuUCUCUCC UCGGCAC UACU Gagc c u UC A - gaaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002175 |
Description | Homo sapiens hsa-miR-485-5p mature miRNA |
Sequence | 9 - AGAGGCUGGCCGUGAUGAAUUC - 30 |
Evidence |
experimental
array-cloned [2], cloned [3] |
Database links | |
Predicted targets |
Accession | MIMAT0002176 |
Description | Homo sapiens hsa-miR-485-3p mature miRNA |
Sequence | 46 - GUCAUACACGGCUCUCCUCUCU - 67 |
Evidence |
experimental
cloned [1,3], array-cloned [2] |
Database links | |
Predicted targets |
|