Stem-loop kshv-mir-K12-10a

Accession

MI0002472

Description

Kaposi sarcoma-associated herpesvirus kshv-mir-K12-10a precursor miRNA

Sequence

cuggaGGCUUGGGGCGAUACCACCACUcguuugucuguuggcgauUAGUGUUGUCCCCCCGAGUGGCcag
((((..((((((((.((((.(((...(((((........)))))...))).)))).))))))))..))))

Structure

    aG        C    C   CAC     ugu 
cugg  GCUUGGGG GAUA CAC   Ucguu   c
||||  |||||||| |||| |||   |||||    
gacC  UGAGCCCC CUGU GUG   agcgg   u
    GG        C    U   AUu     uug 

Annotation confidence Not enough data

Comments

Cai et al. define the likely miRNA primary transcripts in [4].

Genome context

KSU75698: 117967-118036 [-]

Clustered miRNAs

11 other miRNAs are < 10 kb from kshv-mir-K12-10a

Mature kshv-miR-K12-10a-5p

• Accession: MIMAT0015212
• Description: Kaposi sarcoma-associated herpesvirus kshv-miR-K12-10a-5p mature miRNA
• Sequence: 6 - GGCUUGGGGCGAUACCACCACU - 27
• Evidence: experimental ; Illumina [6], SOLiD [7]

Mature kshv-miR-K12-10a-3p

• Accession: MIMAT0002179
• Description: Kaposi sarcoma-associated herpesvirus kshv-miR-K12-10a-3p mature miRNA
• Sequence: 46 - UAGUGUUGUCCCCCCGAGUGGC - 67
• Evidence: experimental ; cloned [1-3,5], Illumina [6], SOLiD [7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15800047
   Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
   "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
   "Proc Natl Acad Sci U S A (2005) 102:5570-5575


3. PubMed ID: 15782219
   Identification of microRNAs of the herpesvirus family
   "Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T"
   "Nat Methods (2005) 2:269-276


4. PubMed ID: 15994824
   Cloning and identification of a microRNA cluster within the latency-associated region of Kaposi's sarcoma-associated herpesvirus
   "Samols MA, Hu J, Skalsky RL, Renne R"
   "J Virol (2005) 79:9301-9305


5. PubMed ID: 16474131
   Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs
   "Cai X, Cullen BR"
   "J Virol (2006) 80:2234-2242


6. PubMed ID: 19889781
   In-depth analysis of Kaposi's sarcoma-associated herpesvirus microRNA expression provides insights into the mammalian microRNA-processing machinery
   "Umbach JL, Cullen BR"
   "J Virol (2010) 84:695-703


7. PubMed ID: 20566670
   Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs
   "Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS"
   "RNA (2010) 16:1540-1558