miRBase entry: hsa-mir-488

Stem-loop hsa-mir-488


Accession
MI0003123
Symbol
HGNC: MIR488
Description
Homo sapiens hsa-mir-488 precursor miRNA mir-488
Gene
family?
RF00861; mir-488

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR488 is identified as one of the differentially expressed microRNAs among 1403 genes, suggesting its potential regulatory role in gene expression [PMC4052096]. It was observed that leptin treatment significantly reduces the levels of MIR488 in mHypoA-POMC/GFP culture, indicating that leptin may influence MIR488 expression [PMC6947463]. Furthermore, MIR488 is implicated in the modulation of MMP-13 activity through its interaction with ZIP, which is induced by IL-1β [PMC3706240]. This microRNA also plays a role in inhibiting epithelial-mesenchymal transition (EMT) by targeting MAPK signaling pathways, which involves different proteins and receptors [PMC7602903]. Specifically, MIR488 has a cause-effect relationship with ZIP8 and is involved in reducing chondrocyte degradation in osteoarthritis [PMC3934988]. The importance of MIR488 extends to its potential involvement with zinc uptake transporters like ZIP8 that are crucial for bone health, particularly given the low bone mineral density observed in type 1 and type 2 diabetes (T1D and T2D) [PMC3934988]. However, the epigenetic effects of intermittent hypoxia (IH) on MIR488 levels have not yet been confirmed in certain models [PMC3934988]. Lastly, although levels of miR-218 and MIR488 are decreased in H. pylori-infected gastric cancer tissues, no significant difference was found between different H. pylori strains affecting these microRNA levels [PMC6365042].

Literature search
28 open access papers mention hsa-mir-488
(167 sentences)

Sequence

607 reads, 15 reads per million, 56 experiments
gagaaucaucucuCCCAGAUAAUGGCACUCUCAAacaaguuuccaaauuguUUGAAAGGCUAUUUCUUGGUCagaugacucuc
((((.((((((..((.(((.((((((.((.((((((((.........)))))))).))))))))))).))..)))))).))))

Structure
    a      cu  C   U      A  C        guu 
gaga ucaucu  CC AGA AAUGGC CU UCAAacaa   u
|||| ||||||  || ||| |||||| || ||||||||   c
cucu aguaga  GG UCU UUAUCG GA AGUUuguu   c
    c      CU  U   -      -  A        aaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-488-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chr1: 177029363-177029445 [-]

Disease association
hsa-mir-488 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-488-5p

Accession MIMAT0002804
Description Homo sapiens hsa-miR-488-5p mature miRNA
Sequence 14 - CCCAGAUAAUGGCACUCUCAA - 34
Evidence experimental
array-cloned [1]

Mature hsa-miR-488-3p

Accession MIMAT0004763
Description Homo sapiens hsa-miR-488-3p mature miRNA
Sequence 52 - UUGAAAGGCUAUUUCUUGGUC - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770