miRBase entry: hsa-mir-488

Stem-loop hsa-mir-488


Accession
MI0003123
Symbol
HGNC: MIR488
Description
Homo sapiens hsa-mir-488 precursor miRNA
Gene family
MIPF0000318; mir-488

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR488 is a microRNA that has been identified among the differentially expressed genes in various studies [PMC4052096]. Leptin treatment has been shown to decrease the levels of MIR488 in mHypoA-POMC/GFP culture [PMC6947463]. There is evidence to suggest that MIR488 may interact with ZIP and modulate MMP-13 activity [PMC3706240]. Additionally, MIR488, along with other microRNAs such as miR30a, miR9, miR1249, and miR497, has been found to inhibit epithelial-mesenchymal transition (EMT) through MAPK signaling [PMC7602903]. A recent study has reported a relationship between MIR488 and ZIP8 in osteoarthritis, where reduced degradation of chondrocytes was observed [PMC3934988]. The roles of zinc uptake transporters like ZIP8 and MIR488 may be crucial in bone health as low bone mineral density is a common symptom of type 1 and type 2 diabetes [PMC3934988'>PMC3934988]. However, the epigenetic effect of intermittent hypoxia on the amount of MIR488 has not been confirmed yet [PMC3934988]. In Helicobacter pylori-infected gastric cancer tissues, both miR-218 and MIR488 were found to be decreased but there was no significant difference between different H. pylori strains [PMC6365042].

References:
- PMC4052096
- PMC6947463
- PMC3706240
- PMC7602903
- PMC3934988
- PMC6365042

Literature search
28 open access papers mention hsa-mir-488
(167 sentences)

Sequence

607 reads, 56 reads per million, 56 experiments
gagaaucaucucuCCCAGAUAAUGGCACUCUCAAacaaguuuccaaauuguUUGAAAGGCUAUUUCUUGGUCagaugacucuc
((((.((((((..((.(((.((((((.((.((((((((.........)))))))).))))))))))).))..)))))).))))

Structure
    a      cu  C   U      A  C        guu 
gaga ucaucu  CC AGA AAUGGC CU UCAAacaa   u
|||| ||||||  || ||| |||||| || ||||||||   c
cucu aguaga  GG UCU UUAUCG GA AGUUuguu   c
    c      CU  U   -      -  A        aaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-488-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chr1: 177029363-177029445 [-]

Disease association
hsa-mir-488 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-488-5p

Accession MIMAT0002804
Description Homo sapiens hsa-miR-488-5p mature miRNA
Sequence 14 - CCCAGAUAAUGGCACUCUCAA - 34
Evidence experimental
array-cloned [1]

Mature hsa-miR-488-3p

Accession MIMAT0004763
Description Homo sapiens hsa-miR-488-3p mature miRNA
Sequence 52 - UUGAAAGGCUAUUUCUUGGUC - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770