miRBase entry: hsa-mir-489

Stem-loop hsa-mir-489


Accession
MI0003124
Symbol
HGNC: MIR489
Description
Homo sapiens hsa-mir-489 precursor miRNA mir-489
Gene
family?
RF00698; mir-489

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR489 is a microRNA implicated in the regulation of muscle satellite cell (MuSC) quiescence and has been identified alongside genes such as CALCR and MIR653 in a specific genomic region [PMC4784275]. It is involved in the maintenance of the quiescent state in MuSCs by repressing the oncogene Dek post-transcriptionally [PMC6303387]. Despite its significant role, MIR489 did not show changes in expression levels after experimental manipulations, suggesting a complex regulatory mechanism [PMC9331933]. Additionally, MIR489 has been linked to cardiac health, where it acts as an antihypertrophic agent by reducing adverse hypertrophy through MyD88 regulation [PMC7123062]. It also serves as a target for the lncRNA cardiac hypertrophy-related factor (chrf), which downregulates MIR489 expression to modulate myocardial hypertrophy [PMC7123062]. In cancer research, overexpression of MIR489 has been observed to downregulate HER2 in breast cancer cell lines, indicating its potential role in cancer biology [PMC4951289]. Furthermore, systematic reviews have correlated downregulation of MIR489 with better prognosis in certain cancers [PMC7827149], highlighting its significance as a biomarker and potential therapeutic target.

Literature search
46 open access papers mention hsa-mir-489
(424 sentences)

Sequence

667 reads, 5 reads per million, 43 experiments
guggcagcuugguGGUCGUAUGUGUGACGCCAUUUacuugaaccuuuaggaGUGACAUCACAUAUACGGCAGCuaaacugcuac
(((((((.(((((.(((((((((((((.(.((((..(((((....))))))))).).))))))))))))).))))).)))))))

Structure
       c     G             C C    Ua     a 
guggcag uuggu GUCGUAUGUGUGA G CAUU  cuuga c
||||||| ||||| ||||||||||||| | ||||  |||||  
caucguc aauCG CGGCAUAUACACU C GUGa  ggauu c
       a     A             A A    --     u 


Annotation confidence Low
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr7: 93483936-93484019 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-489
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-489 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-489-3p

Accession MIMAT0002805
Description Homo sapiens hsa-miR-489-3p mature miRNA
Sequence 52 - GUGACAUCACAUAUACGGCAGC - 73
Evidence experimental
array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-489-5p

Accession MIMAT0026605
Description Homo sapiens hsa-miR-489-5p mature miRNA
Sequence 14 - GGUCGUAUGUGUGACGCCAUUU - 35
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45