Stem-loop hsa-mir-489

Accession

MI0003124

Symbol

HGNC: MIR489

Description

Homo sapiens hsa-mir-489 precursor miRNA mir-489

Gene
family

RF00698; mir-489

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR489 is a microRNA implicated in the regulation of muscle satellite cell (MuSC) quiescence and has been identified alongside genes such as CALCR and MIR653 in a specific genomic region [PMC4784275]. It is involved in the maintenance of the quiescent state in MuSCs by repressing the oncogene Dek post-transcriptionally [PMC6303387]. Despite its significant role, MIR489 did not show changes in expression levels after experimental manipulations, suggesting a complex regulatory mechanism [PMC9331933]. Additionally, MIR489 has been linked to cardiac health, where it acts as an antihypertrophic agent by reducing adverse hypertrophy through MyD88 regulation [PMC7123062]. It also serves as a target for the lncRNA cardiac hypertrophy-related factor (chrf), which downregulates MIR489 expression to modulate myocardial hypertrophy [PMC7123062]. In cancer research, overexpression of MIR489 has been observed to downregulate HER2 in breast cancer cell lines, indicating its potential role in cancer biology [PMC4951289]. Furthermore, systematic reviews have correlated downregulation of MIR489 with better prognosis in certain cancers [PMC7827149], highlighting its significance as a biomarker and potential therapeutic target.

Literature search

46 open access papers mention hsa-mir-489
(424 sentences)

Sequence

667 reads, 5 reads per million, 43 experiments

guggcagcuugguGGUCGUAUGUGUGACGCCAUUUacuugaaccuuuaggaGUGACAUCACAUAUACGGCAGCuaaacugcuac
(((((((.(((((.(((((((((((((.(.((((..(((((....))))))))).).))))))))))))).))))).)))))))

Structure

       c     G             C C    Ua     a 
guggcag uuggu GUCGUAUGUGUGA G CAUU  cuuga c
||||||| ||||| ||||||||||||| | ||||  |||||  
caucguc aauCG CGGCAUAUACACU C GUGa  ggauu c
       a     A             A A    --     u 

Annotation confidence Not enough data

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr7: 93483936-93484019 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-489

Disease association

hsa-mir-489 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-489-3p

• Accession: MIMAT0002805
• Description: Homo sapiens hsa-miR-489-3p mature miRNA
• Sequence: 52 - GUGACAUCACAUAUACGGCAGC - 73
• Evidence: experimental ; array-cloned [1], cloned [2], Illumina [3]

Mature hsa-miR-489-5p

• Accession: MIMAT0026605
• Description: Homo sapiens hsa-miR-489-5p mature miRNA
• Sequence: 14 - GGUCGUAUGUGUGACGCCAUUU - 35
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45