miRBase entry: hsa-mir-490

Stem-loop hsa-mir-490


Accession
MI0003125
Symbol
HGNC: MIR490
Description
Homo sapiens hsa-mir-490 precursor miRNA mir-490
Gene
family?
RF00792; mir-490

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR490 is a microRNA (miRNA) that has been identified as a potential tumor suppressor in various cancers, including bladder, lung, and ovarian cancers [PMC7287171]. It is known to target and suppress the expression of genes such as FOS, HMGA2, CCND1, and CDK1 that are involved in cell proliferation and the cell cycle [PMC7287171]. MIR490 is one of the miRNAs that are methylated in certain cell lines but not in control B cells [PMC5485978]. It has been found to target fewer than 200 genes, which is a relatively small number compared to other miRNAs such as MIR24-2 and MIR142 [PMC7287171]. In extracellular vesicles (EVs) derived from human periodontal ligament stem cells (hPDLSCs), MIR490 is one of five representative miRNAs present [PMC8308278], which suggests its role in intercellular communication. The expression of MIR490 can be regulated by CCAT1 in gastric cancer and has been shown to be negatively correlated with CCAT1 expression; high levels of MIR490 can significantly restrain gastric cancer metastasis [PMC9844612]. In lung cancer specifically, lower expression levels of MIR490 have been associated with poor survival outcomes [PMC7212445]'>PMC7212445], indicating its potential as a prognostic biomarker. Additionally, aberrant expression patterns involving MALAT1 may act as competing endogenous RNA (ceRNA), inhibiting MIR490 and leading to tumor progression through increased HMGA2 expression [PMC7212445].

Literature search
34 open access papers mention hsa-mir-490
(141 sentences)

Sequence

899 reads, 5 reads per million, 19 experiments
uggaggccuugcugguuuggaaaguucauuguucgacaCCAUGGAUCUCCAGGUGGGUcaaguuuagagaugcacCAACCUGGAGGACUCCAUGCUGuugagcuguucacaagcagcggacacuucca
((((((..((((((.(((((((........((((((((.(((((((((((((((.(((((..........)).))).)))))))))..)))))).))))))))..))).))))))))))...))))))

Structure
      -cc      g    -   aguucauu        C      --         G   -  aguu 
uggagg   uugcug uuug gaa        guucgaca CAUGGA  UCUCCAGGU GGU ca    u
||||||   |||||| |||| |||        |||||||| ||||||  ||||||||| ||| ||     
accuuc   ggcgac gaac cuu        cgaguuGU GUACCU  GGAGGUCCA Cca gu    a
      aca      -    a   ------gu        C      CA         A   c  agag 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr7: 136903167-136903294 [+]

Disease association
hsa-mir-490 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-490-5p

Accession MIMAT0004764
Description Homo sapiens hsa-miR-490-5p mature miRNA
Sequence 39 - CCAUGGAUCUCCAGGUGGGU - 58
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-490-3p

Accession MIMAT0002806
Description Homo sapiens hsa-miR-490-3p mature miRNA
Sequence 76 - CAACCUGGAGGACUCCAUGCUG - 97
Evidence experimental
array-cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770