miRBase entry: hsa-mir-511

Stem-loop hsa-mir-511


Accession
MI0003127
Symbol
HGNC: MIR511
Description
Homo sapiens hsa-mir-511 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR511 is a microRNA implicated in various biological processes and diseases, including hepatocellular carcinoma (HCC) [PMC8369952]. It is classified under a group of microRNAs that are expressed in the alimentary system and are responsive to stimuli [PMC8369952]. MIR511, along with Mir455, has been observed to be downregulated in a rat model of diethylnitrosamine (DEN) chemically induced HCC, suggesting its potential role in the pathogenesis of this cancer [PMC8369952]. The interactions between MIR511 and the pseudogene Adh6-ps1 are of particular interest as they may contribute to the understanding of HCC; Adh6-ps1 has been found to be moderately expressed in HCC, and its association with MIR511 could indicate a regulatory role in tumorigenesis [PMC8369952]. Despite challenges in predicting targets for new microRNAs such as MIR511 due to limited sequence data [PMC2394755], studies have shown that MIR511 can enhance Bax expression, thereby inhibiting the growth of radiation-resistant A549 cells and suggesting its involvement in apoptosis mechanisms [PMC6525830].

Literature search
31 open access papers mention hsa-mir-511
(261 sentences)

Sequence

2100 reads, 12 reads per million, 62 experiments
caauagacacccaucGUGUCUUUUGCUCUGCAGUCAguaaauauuuuuuugugAAUGUGUAGCAAAAGACAGAauggugguccauug
((((.(((..((((..(((((((((((.((((.(((.((((......))))))).)))).)))))))))))..))))..))).))))

Structure
    a   ac    cG           C    G   g    ua 
caau gac  ccau  UGUCUUUUGCU UGCA UCA uaaa  u
|||| |||  ||||  ||||||||||| |||| ||| ||||   
guua cug  ggua  ACAGAAAACGA GUGU Agu guuu  u
    c   gu    AG           U    A   -    uu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 17845107-17845193 [+]

Disease association
hsa-mir-511 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-511-5p

Accession MIMAT0002808
Description Homo sapiens hsa-miR-511-5p mature miRNA
Sequence 16 - GUGUCUUUUGCUCUGCAGUCA - 36
Evidence experimental
array-cloned [1], Illumina [2]

Mature hsa-miR-511-3p

Accession MIMAT0026606
Description Homo sapiens hsa-miR-511-3p mature miRNA
Sequence 54 - AAUGUGUAGCAAAAGACAGA - 73
Evidence experimental
Illumina [2]
Database links
Predicted targets

References

  1. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45