Hsa-mir-146b is a microRNA (miRNA) that is notably overexpressed in peripheral blood (PB) natural killer (NK) cells [PMC3640206]. This miRNA targets TRAF6, which is involved in the regulation of the NF-kB signaling pathway, a key player in the control of immune responses and cell survival [PMC3640206]. The down-regulation of TRAF6 by hsa-mir-146b leads to a decrease in NF-kB activity, which can result in suppressed cell proliferation and increased sensitivity to chemotherapy [PMC3640206]. The expression levels of hsa-mir-146b, along with other miRNAs such as hsa-miR-375, hsa-miR-31, hsa-miR-7-2, and hsa-miR-204 were quantitatively analyzed and reported with log2 fold change and adjusted p-values to assess their relative abundance and statistical significance [PMC4918724].
u G AU - UG agc cc ggcacU AGAACUGA UCCAUAGG C ug u || |||||| |||||||| |||||||| | || gg ccgUGG UCUUGACU AGGUGUCC G ac c c - -C C ua gau
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002809 |
| Description | Homo sapiens hsa-miR-146b-5p mature miRNA |
| Sequence | 9 - UGAGAACUGAAUUCCAUAGGCUG - 31 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004766 |
| Description | Homo sapiens hsa-miR-146b-3p mature miRNA |
| Sequence | 46 - GCCCUGUGGACUCAGUUCUGGU - 67 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|