WARNING: This summary was generated by AI. MIR495 is a microRNA implicated in various biological processes, including tumorigenesis and metastasis, and has been identified as a potential player in uveal melanoma (UM) [PMC2902045]. In a study, the combination of MIR495 and doxorubicin (DOX) encapsulated in cell-penetrating carrier molecules (CCM) with surface ligand integration (SLI) and redox-responsive disassembly (R-D) demonstrated significantly enhanced therapeutic efficacy against cancer, with tumor volume reduction [PMC6841775]. MIR495 has also been observed to be overexpressed in the RTT-mouse model, where it is known to repress the expression of Bdnf [PMC8595945]. In lung cancer research focusing on multidrug resistance (MDR), MIR495's role was investigated concerning the regulation of P-glycoprotein (P-gp), a critical factor in drug resistance mechanisms [PMC6841775]. The study utilized MIR495 supplied by Cell Biolabs Inc. to examine its interaction with SLI through gel retardation assays, comparing it against uncoated MIR495 as a control [PMC6841775]. The methodology for coating CCM onto SLI/R-D was analogous to that used for binding MIR495, ensuring consistency in experimental procedures [PMC6841775].
u U - AU - uuu
ugguacc gaaaaGAAGU GC CCAUGUU UUUCG c a
||||||| |||||||||| || ||||||| ||||| | u
acuaugg uuuUUCUUCA CG GGUACAA AAAgc g a
c - U AC a ugu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002817 |
| Description | Homo sapiens hsa-miR-495-3p mature miRNA |
| Sequence | 50 - AAACAAACAUGGUGCACUUCUU - 71 |
| Evidence |
experimental
array-cloned [1], cloned [2], SOLiD [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022924 |
| Description | Homo sapiens hsa-miR-495-5p mature miRNA |
| Sequence | 14 - GAAGUUGCCCAUGUUAUUUUCG - 35 |
| Evidence |
experimental
SOLiD [3] |
| Database links |
|
| Predicted targets |
|
|