MIR495 is a microRNA that has been identified as possibly involved in UM tumorigenesis and/or metastasis [PMC2902045]. In a study exploring its role in the regulation of P-gp in MDR lung cancer cells, MIR495 was found to have a greatly elevated efficacy when combined with DOX in CCM/SLI/R-D, resulting in negative volume growth [PMC6841775]. In the RTT-mouse model, MIR495 was found to be significantly overexpressed and described to repress Bdnf [PMC8595945]. The binding ability of SLI to MIR495 was studied using a gel retardation assay, with naked MIR495 serving as a control [PMC6841775]. Additionally, the coating of CCM onto SLI/R-D followed a similar protocol as the binding of MIR495 [PMC6841775]. The EMT- and cancer stemness-promoting activities of intracellular GRP78 may be downregulated by certain endogenous protein factors such as DAL-1 [PMC7226806]. Overall, while limited studies are available on the role of miRNAs, including MIR495, their potential involvement in UM tumorigenesis and metastasis is being investigated [PMC2902045].
u U - AU - uuu ugguacc gaaaaGAAGU GC CCAUGUU UUUCG c a ||||||| |||||||||| || ||||||| ||||| | u acuaugg uuuUUCUUCA CG GGUACAA AAAgc g a c - U AC a ugu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002817 |
Description | Homo sapiens hsa-miR-495-3p mature miRNA |
Sequence | 50 - AAACAAACAUGGUGCACUUCUU - 71 |
Evidence |
experimental
array-cloned [1], cloned [2], SOLiD [3] |
Database links | |
Predicted targets |
Accession | MIMAT0022924 |
Description | Homo sapiens hsa-miR-495-5p mature miRNA |
Sequence | 14 - GAAGUUGCCCAUGUUAUUUUCG - 35 |
Evidence |
experimental
SOLiD [3] |
Database links | |
Predicted targets |
|