WARNING: This summary was generated by AI. MIR181D is a microRNA implicated in various biological processes and diseases [PMC9396029]. It is located upstream of its precursor transcription start sites and has been associated with systemic lupus erythematosus susceptibility in a Chinese population [PMC9396029]. The microRNA has been shown to play a role in tumor suppression by downregulating MALT1, which inhibits tumor cell growth [PMC6125328]. However, there is no compensatory up-regulation of MIR181D observed in miR-181a/b-1 knockout thymocytes, indicating its unique regulatory functions [PMC4682956]. MIR181D also influences T helper cells by modulating the activity of the enzyme SOAT2, which is involved in cholesterol metabolism [PMC7460638]. Additionally, it can act as a transcriptional regulator by binding to DNA promoters [PMC9967498]. In the context of chronic obstructive pulmonary disease (COPD), MIR181D expression is downregulated in lung tissue, suggesting its involvement in the disease's gene regulation mechanisms [PMC6089098]. Moreover, it interacts with various biological molecules such as pseudogenes and other miRNAs as revealed by next-generation sequencing and bioinformatic analyses of COPD bronchial epithelial cells [PMC9730017].
-- - ----aca ga aucA GUUG g a gac
gucccc uccccu aggcc gcc ggucaca ACAUUCAUU UCGGUGGGUU ug g u
|||||| |||||| ||||| ||| ||||||| ||||||||| |||||||||| || |
cagggg agggga uucgg cgg ucggugu UGUAAGUAG GGCCACCcag ac c g
ua a cacagac -g -cAC --GG - - gga
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002821 |
| Description | Homo sapiens hsa-miR-181d-5p mature miRNA |
| Sequence | 36 - AACAUUCAUUGUUGUCGGUGGGUU - 59 |
| Evidence |
experimental
array-cloned [1], cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026608 |
| Description | Homo sapiens hsa-miR-181d-3p mature miRNA |
| Sequence | 79 - CCACCGGGGGAUGAAUGUCA - 98 |
| Evidence |
experimental
Illumina [3] |
| Database links |
|
| Predicted targets |
|
|