miRBase entry: hsa-mir-181d

Stem-loop hsa-mir-181d


Accession
MI0003139
Symbol
HGNC: MIR181D
Description
Homo sapiens hsa-mir-181d precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR181D is a microRNA implicated in various biological processes and diseases [PMC9396029]. It is located upstream of its precursor transcription start sites and has been associated with systemic lupus erythematosus susceptibility in a Chinese population [PMC9396029]. The microRNA has been shown to play a role in tumor suppression by downregulating MALT1, which inhibits tumor cell growth [PMC6125328]. However, there is no compensatory up-regulation of MIR181D observed in miR-181a/b-1 knockout thymocytes, indicating its unique regulatory functions [PMC4682956]. MIR181D also influences T helper cells by modulating the activity of the enzyme SOAT2, which is involved in cholesterol metabolism [PMC7460638]. Additionally, it can act as a transcriptional regulator by binding to DNA promoters [PMC9967498]. In the context of chronic obstructive pulmonary disease (COPD), MIR181D expression is downregulated in lung tissue, suggesting its involvement in the disease's gene regulation mechanisms [PMC6089098]. Moreover, it interacts with various biological molecules such as pseudogenes and other miRNAs as revealed by next-generation sequencing and bioinformatic analyses of COPD bronchial epithelial cells [PMC9730017].

Literature search
320 open access papers mention hsa-mir-181d
(1015 sentences)

Sequence

90532 reads, 160.0 reads per million, 175 experiments
guccccuccccuaggccacagccgaggucacaaucAACAUUCAUUGUUGUCGGUGGGUUgugaggacugaggccagacCCACCGGGGGAUGAAUGUCAcuguggcugggccagacacggcuuaaggggaauggggac
(((((((((((((((((...(((..(((((((....(((((((((....((((((((((.((.(........)))))))))))))..)))))))))...))))))).))).......))))).))))))..))))))

Structure
      --      -     ----aca   ga       aucA         GUUG          g  a gac 
gucccc  uccccu aggcc       gcc  ggucaca    ACAUUCAUU    UCGGUGGGUU ug g   u
||||||  |||||| |||||       |||  |||||||    |||||||||    |||||||||| || |    
cagggg  agggga uucgg       cgg  ucggugu    UGUAAGUAG    GGCCACCcag ac c   g
      ua      a     cacagac   -g       -cAC         --GG          -  - gga 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr19: 13874875-13875011 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181d
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181d is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-181d-5p

Accession MIMAT0002821
Description Homo sapiens hsa-miR-181d-5p mature miRNA
Sequence 36 - AACAUUCAUUGUUGUCGGUGGGUU - 59
Evidence experimental
array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-181d-3p

Accession MIMAT0026608
Description Homo sapiens hsa-miR-181d-3p mature miRNA
Sequence 79 - CCACCGGGGGAUGAAUGUCA - 98
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45