miRBase entry: hsa-mir-512-1

Stem-loop hsa-mir-512-1


Accession
MI0003140
Symbol
HGNC: MIR512-1
Description
Homo sapiens hsa-mir-512-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR512-1 is a miRNA gene belonging to the C19MC miRNA cluster, which is known for its complex methylation patterns and tissue-specific expression [PMC3975056]. The TCGA miRNA-seq dataset for liver hepatocellular carcinoma (LIHC) and the HCC-iCluster RNA-seq dataset were integrated to analyze the expression of C19MC miRNAs, including MIR512-1 [PMC7378193]. Methylation profiling has revealed that the MIR512-1 cluster's promoter is maternally methylated in placental tissue but fully methylated in somatic tissues, indicating a tissue-specific methylation pattern [PMC3975056]. The differentially methylated region (DMR) of MIR512-1 is unmethylated in hydatidiform moles and partially methylated in placenta, spanning approximately 5 kb including a promoter CpG island [PMC3975056]. Unlike most placental-specific DMRs, which do not inherit methylation from gametes and are unmethylated in human embryonic stem cells (hES cells), MIR512-1 exhibits restricted paternal expression in placenta with complex allelic expression patterns [PMC3975056'>PMC3975056]. This unique imprinting pattern of MIR512-1 does not extend to the nearby MIR371/2 cluster but does show reciprocal imprinting with ZNF331 [PMC3975056]. The study also raises the possibility of additional unknown imprinted DMRs that may exist exclusively in placental tissues, as suggested by the distinct methylation profiles of MIR512-1 and GPR1-AS DMRs [PMC3975056].

Literature search
44 open access papers mention hsa-mir-512-1
(260 sentences)

Sequence

359 reads, 4.0 reads per million, 36 experiments
ucucagucuguggCACUCAGCCUUGAGGGCACUUUCuggugccagaaugaAAGUGCUGUCAUAGCUGAGGUCcaaugacugagg
.(((((((..(((..((((((..(((.(((((((((............))))))))).)))..))))))..)))..))))))).

Structure
u       ug   CA      CU   G         uggug 
 cucaguc  ugg  CUCAGC  UGA GGCACUUUC     c
 |||||||  |||  ||||||  ||| |||||||||      
 gagucag  acC  GAGUCG  ACU UCGUGAAag     c
g       ua   UG      AU   G         uaaga 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 53666679-53666762 [+]
Clustered miRNAs
4 other miRNAs are < 10 kb from hsa-mir-512-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-512-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-512-5p

Accession MIMAT0002822
Description Homo sapiens hsa-miR-512-5p mature miRNA
Sequence 14 - CACUCAGCCUUGAGGGCACUUUC - 36
Evidence experimental
array-cloned [1]

Mature hsa-miR-512-3p

Accession MIMAT0002823
Description Homo sapiens hsa-miR-512-3p mature miRNA
Sequence 51 - AAGUGCUGUCAUAGCUGAGGUC - 72
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770