miRBase entry: hsa-mir-519c

Stem-loop hsa-mir-519c


Accession
MI0003148
Symbol
HGNC: MIR519C
Description
Homo sapiens hsa-mir-519c precursor miRNA mir-515
Gene
family?
RF00639; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR519C is a placenta-specific microRNA gene belonging to the C19MC cluster, which is known to play a role in the regulation of gene expression, particularly in the placenta where it is produced by trophoblasts [PMC6460512]. This microRNA can be released in different forms, including as free miRNA or within extracellular vesicles (EVs) [PMC6460512]. In individuals from Australia, MIR519C and its target gene PDCD1LG2 were found to be disrupted by copy number variations (CNVs), indicating a potential impact on gene regulation [PMC3938728]. MIR519C has been implicated in the inhibition of TNFα gene expression within placental explant models, suggesting its involvement in inflammatory response modulation [PMC6460512]. Additionally, MIR519C has been associated with effects on transcription stability and protein translation [PMC10138346]. The expression of MIR519C has been analyzed in various datasets including those from liver hepatocellular carcinoma (LIHC) and breast invasive carcinoma, indicating its relevance in cancer research and potential role in tumorigenesis as part of the C19MC miRNA cluster [PMC7378193; PMC6193703; PMC8508841]..

Literature search
52 open access papers mention hsa-mir-519c
(116 sentences)

Sequence

160 reads, 3.0 reads per million, 31 experiments
ucucagccugugaccCUCUAGAGGGAAGCGCUUUCUGuugucugaaagaaaagAAAGUGCAUCUUUUUAGAGGAUuacaguuugaga
((((((.((((((.((((((((((((.(((((((((....(((...)))..))))))))).)))))))))))).)))))).))))))

Structure
      c      c            A         Guug   g 
ucucag cuguga cCUCUAGAGGGA GCGCUUUCU    ucu  
|||||| |||||| |||||||||||| |||||||||    ||| a
agaguu gacauU GGAGAUUUUUCU CGUGAAAga    aga  
      u      A            A         --aa   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr19: 53686469-53686555 [+]
Clustered miRNAs
8 other miRNAs are < 10 kb from hsa-mir-519c
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-519c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-519c-5p

Accession MIMAT0002831
Description Homo sapiens hsa-miR-519c-5p mature miRNA
Sequence 16 - CUCUAGAGGGAAGCGCUUUCUG - 37
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-519c-3p

Accession MIMAT0002832
Description Homo sapiens hsa-miR-519c-3p mature miRNA
Sequence 54 - AAAGUGCAUCUUUUUAGAGGAU - 75
Evidence experimental
array-cloned [1]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770