MIR524 is a microRNA gene that is part of the C19MC miRNA cluster, which includes a total of 46 miRNA genes [PMC6193703]. This gene plays a significant role in the regulation of various pathways, as its downregulation has been associated with the activation of the TGF-β, Notch, and Hippo pathways due to an overexpressed EGFR/myc axis in breast invasive carcinoma [PMC9966483]. Additionally, MIR524 has been identified as a regulator of MXD1 and is influenced by copy number variations (CNVs) along with other microRNAs such as mir1283 and mir520d [PMC3938728]. In liver hepatocellular carcinoma (LIHC), MIR524 expression was analyzed as part of an integrated dataset that combined miRNA-seq and RNA-seq data to provide insights into its role in cancer [PMC7378193]. Furthermore, EGFR has been shown to negatively regulate MIR524 by recruiting repressive histone modifiers to its promoter region, which results in reduced production of pri-miR-524 [PMC7766154].
u c A A Cuug a
ucuca gcugugac CU CAAAGGGAAGC CUUUCU ucc
||||| |||||||| || ||||||||||| |||||| ||| a
agagu uggcauug GA GUUUCCCUUCG GGAAGa agg
u U G C --aa a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002849 |
| Description | Homo sapiens hsa-miR-524-5p mature miRNA |
| Sequence | 16 - CUACAAAGGGAAGCACUUUCUC - 37 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0002850 |
| Description | Homo sapiens hsa-miR-524-3p mature miRNA |
| Sequence | 53 - GAAGGCGCUUCCCUUUGGAGU - 73 |
| Evidence |
experimental
array-cloned [1] |
|