miRBase entry: hsa-mir-524

Stem-loop hsa-mir-524


Accession
MI0003160
Symbol
HGNC: MIR524
Description
Homo sapiens hsa-mir-524 precursor miRNA mir-515
Gene
family?
RF00639; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR524 is a microRNA gene that is part of the C19MC miRNA cluster, which includes a total of 46 miRNA genes [PMC6193703]. This gene plays a significant role in the regulation of various pathways, as its downregulation has been associated with the activation of the TGF-β, Notch, and Hippo pathways due to an overexpressed EGFR/myc axis in breast invasive carcinoma [PMC9966483]. Additionally, MIR524 has been identified as a regulator of MXD1 and is influenced by copy number variations (CNVs) along with other microRNAs such as mir1283 and mir520d [PMC3938728]. In liver hepatocellular carcinoma (LIHC), MIR524 expression was analyzed as part of an integrated dataset that combined miRNA-seq and RNA-seq data to provide insights into its role in cancer [PMC7378193]. Furthermore, EGFR has been shown to negatively regulate MIR524 by recruiting repressive histone modifiers to its promoter region, which results in reduced production of pri-miR-524 [PMC7766154].

Literature search
16 open access papers mention hsa-mir-524
(254 sentences)

Sequence

59 reads, 2 reads per million, 15 experiments
ucucaugcugugaccCUACAAAGGGAAGCACUUUCUCuuguccaaaggaaaaGAAGGCGCUUCCCUUUGGAGUguuacgguuugaga
(((((.((((((((.((.(((((((((((.((((((....(((...)))..)))))).))))))))))).)).)))))))).)))))

Structure
     u        c  A           A      Cuug   a 
ucuca gcugugac CU CAAAGGGAAGC CUUUCU    ucc  
||||| |||||||| || ||||||||||| ||||||    ||| a
agagu uggcauug GA GUUUCCCUUCG GGAAGa    agg  
     u        U  G           C      --aa   a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 53711002-53711088 [+]
Clustered miRNAs
9 other miRNAs are < 10 kb from hsa-mir-524
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-524 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-524-5p

Accession MIMAT0002849
Description Homo sapiens hsa-miR-524-5p mature miRNA
Sequence 16 - CUACAAAGGGAAGCACUUUCUC - 37
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-524-3p

Accession MIMAT0002850
Description Homo sapiens hsa-miR-524-3p mature miRNA
Sequence 53 - GAAGGCGCUUCCCUUUGGAGU - 73
Evidence experimental
array-cloned [1]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770