miRBase entry: hsa-mir-519d

Stem-loop hsa-mir-519d


Accession
MI0003162
Symbol
HGNC: MIR519D
Description
Homo sapiens hsa-mir-519d precursor miRNA mir-515
Gene
family?
RF00639; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR519D is a microRNA implicated in various cellular processes and diseases, including cancer [PMC8235499]. While it was not up-regulated in hypoxic hepatocellular carcinoma (HCC) cells [PMC5074303], it has been reported to be overexpressed in the majority of central nervous system (CNS) tumors, contradicting a previous report of its down-regulation and tumor-suppressive properties [PMC8235499]. In the context of non-alcoholic fatty liver disease (NAFLD), MIR519D is among the miRNAs that are elevated and directly target PPARα mRNA [PMC9775974]. It has been validated to play a role in HCC tumorigenesis, along with other differentially expressed miRNAs (DEMs) [PMC6338110]. MIR519D is also associated with stem cell biology and tumorigenesis as part of the chromosome 19 microRNA cluster C19MC [PMC8508841]. Its expression was found to be increased in adipogenesis promoting stem cells but decreased in a subsequent stage of these cells, indicating its role in adipogenesis regulation [PMC6307768]. Furthermore, hypomethylation has been associated with increased expression of MIR519D in HCC, suggesting epigenetic regulation as a factor influencing its expression levels [PMC8904560].

Literature search
42 open access papers mention hsa-mir-519d
(164 sentences)

Sequence

54 reads, 6 reads per million, 12 experiments
ucccaugcugugacCCUCCAAAGGGAAGCGCUUUCUGUUuguuuucucuuaaaCAAAGUGCCUCCCUUUAGAGUGuuaccguuuggga
(((((.((.(((((.(((.(((((((.((((((..((((((........)))))))))))).))))))).))).))))).)).)))))

Structure
     u  u     C   C       A      UC      uuu 
uccca gc gugac CUC AAAGGGA GCGCUU  UGUUug   u
||||| || ||||| ||| ||||||| ||||||  ||||||    
agggu ug cauuG GAG UUUCCCU CGUGAA  ACaaau   c
     u  c     U   A       C      --      ucu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr19: 53713347-53713434 [+]
Clustered miRNAs
9 other miRNAs are < 10 kb from hsa-mir-519d
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-519d is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-519d-3p

Accession MIMAT0002853
Description Homo sapiens hsa-miR-519d-3p mature miRNA
Sequence 54 - CAAAGUGCCUCCCUUUAGAGUG - 75
Evidence experimental
array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-519d-5p

Accession MIMAT0026610
Description Homo sapiens hsa-miR-519d-5p mature miRNA
Sequence 15 - CCUCCAAAGGGAAGCGCUUUCUGUU - 39
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45