Hsa-mir-517b is a microRNA that has been associated with lower cancer stages and improved patient survival [PMC7648123]. It is one of six miRNAs, including hsa-mir-517b, that have been found to be associated with stages I-III of cancer [PMC7499949]. Hsa-mir-517b is differentially expressed during NaB-induced differentiation and represents an endodermal miRNA [PMC2581805]. The presence of certain genetic mutations, such as rs1063053 and rs1063054, can affect the binding sites of hsa-mir-517b and other miRNAs [PMC5810033]. Hsa-mir-517b has been analyzed using pre-designed TaqMan® MicroRNA assays [PMC3937405]. It is important in diminishing the pluripotency state and the chondrogenic process [PMC6770352]. Hsa-mir-517b is part of the Hsa-miR-517 family, which includes three isoforms transcribed from the C19MC cluster [PMC8666996]. In summary, hsa-mir-517b is a microRNA that has been associated with lower cancer stages and improved patient survival. It is differentially expressed during NaB-induced differentiation and represents an endodermal miRNA. Certain genetic mutations can affect its binding sites. Hsa-mir-517b has been analyzed using pre-designed TaqMan® MicroRNA assays. It plays a crucial role in diminishing pluripotency state and chondrogenic process. It belongs to the Hsa-miR-517 family transcribed from the C19MC cluster.
C U A U guugu gugac CUCUAGA GGA GCAC GUCU c ||||| ||||||| ||| |||| |||| u cauUG GAGAUUU CCU CGUG UAga a U C A C aaaga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002851 |
Description | Homo sapiens hsa-miR-517-5p mature miRNA |
Sequence | 6 - CCUCUAGAUGGAAGCACUGUCU - 27 |
Evidence |
experimental
array-cloned [1] |
Accession | MIMAT0002857 |
Description | Homo sapiens hsa-miR-517b-3p mature miRNA |
Sequence | 43 - AUCGUGCAUCCCUUUAGAGUGU - 64 |
Evidence |
experimental
array-cloned [1] |
Database links | |
Predicted targets |
|