miRBase entry: hsa-mir-520g

Stem-loop hsa-mir-520g


Accession
MI0003166
Symbol
HGNC: MIR520G
Description
Homo sapiens hsa-mir-520g precursor miRNA mir-515
Gene
family?
RF00639; mir-515

Literature search
33 open access papers mention hsa-mir-520g
(94 sentences)

Sequence

61 reads, 3 reads per million, 17 experiments
ucccaugcugugacccUCUAGAGGAAGCACUUUCUGUUUguugucugagaaaaaACAAAGUGCUUCCCUUUAGAGUGUuaccguuuggga
(((((.((.(((((.(((((((((((((((((..(((((.............))))))))))))).))))))))).))))).)).)))))

Structure
     u  u     c         -        UC     guugu 
uccca gc gugac cUCUAGAGG AAGCACUU  UGUUU     c
||||| || ||||| ||||||||| ||||||||  |||||     u
agggu ug cauUG GAGAUUUCC UUCGUGAA  ACAaa     g
     u  c     U         C        --     aaaga 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr19: 53722166-53722255 [+]
Clustered miRNAs
9 other miRNAs are < 10 kb from hsa-mir-520g
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-520g is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-520g-3p

Accession MIMAT0002858
Description Homo sapiens hsa-miR-520g-3p mature miRNA
Sequence 55 - ACAAAGUGCUUCCCUUUAGAGUGU - 78
Evidence experimental
array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-520g-5p

Accession MIMAT0026611
Description Homo sapiens hsa-miR-520g-5p mature miRNA
Sequence 17 - UCUAGAGGAAGCACUUUCUGUUU - 39
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45