hsa-mir-518e is a microRNA that has been identified as upregulated in pancreatic ductal adenocarcinoma (PDAC) tissues compared to adjacent normal controls, indicating a potential role in tumorigenesis [PMC5649611]. This microRNA was also found to be significantly dysregulated in a limited number of comparisons, suggesting a more specific rather than widespread change in expression across various conditions [PMC4268797]. In the context of neural stem cell (NSC) differentiation from induced pluripotent stem cells (iPSCs), hsa-mir-518e expression is significantly decreased, which implies that it may act as a negative regulator of neural differentiation [PMC6696086]. This role is further supported by the observation that hsa-mir-518e, along with other miRNAs, was identified as potentially characteristic for the transition from iPSCs to NSCs [PMC6696086]. Additionally, hsa-mir-518e has been found to be upregulated in hepatocellular carcinoma (HCC), suggesting its involvement in multiple cancer types and highlighting its potential as a biomarker or therapeutic target [PMC5937522].
- ug c A Guuggc ucucag gc ugac CUCU GAGGGAAGCGCUUUCU u |||||| || |||| |||| |||||||||||||||| a agaguu cg auuG GAGA UUCCCUUCGCGAAAga a u ca U C aaagaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005450 |
Description | Homo sapiens hsa-miR-518e-5p mature miRNA |
Sequence | 16 - CUCUAGAGGGAAGCGCUUUCUG - 37 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002861 |
Description | Homo sapiens hsa-miR-518e-3p mature miRNA |
Sequence | 54 - AAAGCGCUUCCCUUCAGAGUG - 74 |
Evidence |
experimental
array-cloned [1], cloned [2] |
|