miRBase entry: hsa-mir-518e

Stem-loop hsa-mir-518e


Accession
MI0003169
Symbol
HGNC: MIR518E
Description
Homo sapiens hsa-mir-518e precursor miRNA mir-515
Gene
family?
RF00639; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

hsa-mir-518e is a microRNA that has been identified as upregulated in pancreatic ductal adenocarcinoma (PDAC) tissues compared to adjacent normal controls, indicating a potential role in tumorigenesis [PMC5649611]. This microRNA was also found to be significantly dysregulated in a limited number of comparisons, suggesting a more specific rather than widespread change in expression across various conditions [PMC4268797]. In the context of neural stem cell (NSC) differentiation from induced pluripotent stem cells (iPSCs), hsa-mir-518e expression is significantly decreased, which implies that it may act as a negative regulator of neural differentiation [PMC6696086]. This role is further supported by the observation that hsa-mir-518e, along with other miRNAs, was identified as potentially characteristic for the transition from iPSCs to NSCs [PMC6696086]. Additionally, hsa-mir-518e has been found to be upregulated in hepatocellular carcinoma (HCC), suggesting its involvement in multiple cancer types and highlighting its potential as a biomarker or therapeutic target [PMC5937522].

Literature search
9 open access papers mention hsa-mir-518e
(11 sentences)

Sequence

96 reads, 3 reads per million, 18 experiments
ucucaggcugugaccCUCUAGAGGGAAGCGCUUUCUGuuggcuaaaagaaaagAAAGCGCUUCCCUUCAGAGUGuuaacgcuuugaga
((((((((..((((.((((.((((((((((((((((...............)))))))))))))))).)))).))))..)).))))))

Structure
      -  ug    c    A                Guuggc 
ucucag gc  ugac CUCU GAGGGAAGCGCUUUCU      u
|||||| ||  |||| |||| ||||||||||||||||      a
agaguu cg  auuG GAGA UUCCCUUCGCGAAAga      a
      u  ca    U    C                aaagaa 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr19: 53729838-53729925 [+]
Clustered miRNAs
9 other miRNAs are < 10 kb from hsa-mir-518e
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-518e is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-518e-5p

Accession MIMAT0005450
Description Homo sapiens hsa-miR-518e-5p mature miRNA
Sequence 16 - CUCUAGAGGGAAGCGCUUUCUG - 37
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-518e-3p

Accession MIMAT0002861
Description Homo sapiens hsa-miR-518e-3p mature miRNA
Sequence 54 - AAAGCGCUUCCCUUCAGAGUG - 74
Evidence experimental
array-cloned [1], cloned [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770