miRBase entry: hsa-mir-499a

Stem-loop hsa-mir-499a


Accession
MI0003183
Symbol
HGNC: MIR499A
Description
Homo sapiens hsa-mir-499a precursor miRNA mir-499
Gene
family?
RF00745; mir-499

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR499A is a microRNA implicated in various cellular processes, and its expression and potential associations with diseases have been a subject of research [PMC4207808]. In a recent study, no significant correlation was found between the rs3746444 polymorphism of MIR499A and the expression levels of miR-499a [PMC8514969]. This suggests that this particular polymorphism may not play a role in regulating MIR499A expression or its functional consequences. Furthermore, the study investigated MIR499A expression in HepG2 cells, a human liver cancer cell line, following infection with either adenovirus expressing hepatitis B virus (Ad-HBV) or adenovirus expressing green fluorescent protein (Ad-GFP) [PMC4207808]. This was likely done to understand the impact of viral infection on MIR499A expression. Additionally, to elucidate the functional role of MIR499A in hepatocellular carcinoma (HCC), researchers identified and explored its target gene [PMC4207808]. The identification of target genes is crucial for understanding the molecular mechanisms through which microRNAs like MIR499A exert their effects on cellular functions and disease progression.

Literature search
136 open access papers mention hsa-mir-499a
(778 sentences)

Sequence

67945 reads, 526 reads per million, 101 experiments
gcccuguccccugugccuugggcgggcggcugUUAAGACUUGCAGUGAUGUUUaacuccucuccacgugAACAUCACAGCAAGUCUGUGCUgcuucccgucccuacgcugccugggcagggu
(((((((((.....((...(((((((.(((.((..((((((((.((((((((((.............)))))))))).))))))))..)).))).)))).)))...)).....)))))))))

Structure
         ccugu  cuu   -    c   u  UA        A          acucc 
gcccugucc     gc   ggg cggg ggc gU  AGACUUGC GUGAUGUUUa     u
|||||||||     ||   ||| |||| ||| ||  |||||||| ||||||||||     c
ugggacggg     cg   ccc gccc ucg CG  UCUGAACG CACUACAAgu     u
         uccgu  cau   u    u   U  UG        A          gcacc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr20: 34990376-34990497 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-499a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-499a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-499a-5p

Accession MIMAT0002870
Description Homo sapiens hsa-miR-499a-5p mature miRNA
Sequence 33 - UUAAGACUUGCAGUGAUGUUU - 53
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-499a-3p

Accession MIMAT0004772
Description Homo sapiens hsa-miR-499a-3p mature miRNA
Sequence 70 - AACAUCACAGCAAGUCUGUGCU - 91
Evidence experimental
cloned [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770