WARNING: This summary was generated by AI. MIR500A is a microRNA whose expression can be influenced by pharmacological interventions, as evidenced by a study where specific drugs were found to increase MIR500A promoter activity, suggesting a potential regulatory mechanism influenced by these compounds [PMC8253104]. The study further confirmed the specificity of the drugs' effect on MIR500A expression by demonstrating that treatment of parental SAOS 2 cells, which presumably do not have the same genetic alterations as the targeted cells, did not result in altered MIR500A expression [PMC8253104]. This finding is significant as it helps to rule out off-target effects of the drugs, reinforcing that the observed increase in promoter activity is likely due to a direct effect on MIR500A regulation [PMC8253104].
c c -U UAC AGAg ugu
gcuc c cucuc AAUCCUUGC CUGGGUG ugc c
|||| | ||||| ||||||||| ||||||| ||| u
cgag g gagaG UUAGGAACG GGUCCAC acg g
a c UC --- -GUA uaa
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004773 |
| Description | Homo sapiens hsa-miR-500a-5p mature miRNA |
| Sequence | 13 - UAAUCCUUGCUACCUGGGUGAGA - 35 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0002871 |
| Description | Homo sapiens hsa-miR-500a-3p mature miRNA |
| Sequence | 52 - AUGCACCUGGGCAAGGAUUCUG - 73 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
|