miRBase entry: hsa-mir-501

Stem-loop hsa-mir-501


Accession
MI0003185
Symbol
HGNC: MIR501
Description
Homo sapiens hsa-mir-501 precursor miRNA mir-500
Gene
family?
RF01903; mir-500

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR501 is a microRNA (miRNA) that has been identified as one of the most elevated plasma miRNAs in community-acquired pneumonia (CAP) [PMC8358855]. While it is part of a novel miRNA family discovered in wheat, its association with schizophrenia is through single-nucleotide polymorphisms and protein-altering variants in the human host gene CLCN5, not the wheat gene [PMC5360763, PMC9390987].'>PMC9390987].. MIR501 is located on the X chromosome within the intronic region of the CLCN5 gene, and its major mature form, miR-501-3p, is highly expressed in various tissues and specific neuronal types [PMC9390987]. Studies using MIR501-knockout (KO) mice have demonstrated that its absence leads to reduced levels of mature mmu-miR-501-3p and mmu-miR-501-5p in the brain, without affecting nearby miRNAs [PMC9390987]. Conditional rescue experiments have indicated that miR-501-3p may play a role in modulating glutamatergic transmission, which could be significant for understanding the pathophysiology of schizophrenia [PMC9390987]. Due to the MIR501 locus's location on the X chromosome, male mice were used in experiments to circumvent the variability of X-chromosome inactivation that could complicate results in females [PMC9390987].

Literature search
35 open access papers mention hsa-mir-501
(59 sentences)

Sequence

9875 reads, 45 reads per million, 128 experiments
gcucuuccucucuAAUCCUUUGUCCCUGGGUGAGAgugcuuucugaaugcAAUGCACCCGGGCAAGGAUUCUgagagggugagc
((((.(((((((.(((((((.(.(((.(((((....(((.........)))...))))))))))))))))..))))))).))))

Structure
    u       -u       U U   U     AGAg   uuu 
gcuc uccucuc  AAUCCUU G CCC GGGUG    ugc   c
|||| |||||||  ||||||| | ||| |||||    |||   u
cgag gggagag  UUAGGAA C GGG CCCAC    Acg   g
    u       UC       - -   -     -GUA   uaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 50009722-50009805 [+]
Clustered miRNAs
7 other miRNAs are < 10 kb from hsa-mir-501
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-501 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-501-5p

Accession MIMAT0002872
Description Homo sapiens hsa-miR-501-5p mature miRNA
Sequence 14 - AAUCCUUUGUCCCUGGGUGAGA - 35
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-501-3p

Accession MIMAT0004774
Description Homo sapiens hsa-miR-501-3p mature miRNA
Sequence 51 - AAUGCACCCGGGCAAGGAUUCU - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770