WARNING: This summary was generated by AI. MIR501 is a microRNA (miRNA) that has been identified as one of the most elevated plasma miRNAs in community-acquired pneumonia (CAP) [PMC8358855]. While it is part of a novel miRNA family discovered in wheat, its association with schizophrenia is through single-nucleotide polymorphisms and protein-altering variants in the human host gene CLCN5, not the wheat gene [PMC5360763, PMC9390987].'>PMC9390987].. MIR501 is located on the X chromosome within the intronic region of the CLCN5 gene, and its major mature form, miR-501-3p, is highly expressed in various tissues and specific neuronal types [PMC9390987]. Studies using MIR501-knockout (KO) mice have demonstrated that its absence leads to reduced levels of mature mmu-miR-501-3p and mmu-miR-501-5p in the brain, without affecting nearby miRNAs [PMC9390987]. Conditional rescue experiments have indicated that miR-501-3p may play a role in modulating glutamatergic transmission, which could be significant for understanding the pathophysiology of schizophrenia [PMC9390987]. Due to the MIR501 locus's location on the X chromosome, male mice were used in experiments to circumvent the variability of X-chromosome inactivation that could complicate results in females [PMC9390987].
u -u U U U AGAg uuu
gcuc uccucuc AAUCCUU G CCC GGGUG ugc c
|||| ||||||| ||||||| | ||| ||||| ||| u
cgag gggagag UUAGGAA C GGG CCCAC Acg g
u UC - - - -GUA uaa
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002872 |
| Description | Homo sapiens hsa-miR-501-5p mature miRNA |
| Sequence | 14 - AAUCCUUUGUCCCUGGGUGAGA - 35 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004774 |
| Description | Homo sapiens hsa-miR-501-3p mature miRNA |
| Sequence | 51 - AAUGCACCCGGGCAAGGAUUCU - 72 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|