MIR502 is a microRNA that has been studied for its role in cellular processes, particularly in the context of the cell cycle in PaTuT cells, as evidenced by flow cytometry analysis [PMC7002776]. The impact of MIR502 on cell cycle regulation suggests that it may play a significant role in cellular proliferation and differentiation within these specific tissues where it is prominently expressed [PMC7002776].
u - UAU UAg ugg gcucccccucucu aAUCCUUGC CUGGGUGC ugc c ||||||||||||| ||||||||| |||||||| ||| u cgagggggagagA UUAGGAACG GGUCCACG Acg c u C --- -UA uaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002873 |
Description | Homo sapiens hsa-miR-502-5p mature miRNA |
Sequence | 16 - AUCCUUGCUAUCUGGGUGCUA - 36 |
Evidence |
experimental
array-cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004775 |
Description | Homo sapiens hsa-miR-502-3p mature miRNA |
Sequence | 52 - AAUGCACCUGGGCAAGGAUUCA - 73 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|