miRBase entry: hsa-mir-504

Stem-loop hsa-mir-504


Accession
MI0003189
Symbol
HGNC: MIR504
Description
Homo sapiens hsa-mir-504 precursor miRNA mir-504
Gene
family?
RF00939; mir-504

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR504, a microRNA implicated in cell cycle regulation through the p53 pathway, has been observed to be downregulated in neurological disorders and is considered a potential therapeutic target for diseases such as ALS [PMC6031650]. It is ubiquitously expressed across various tissues and has been identified as having target sites in wheat unigenes, suggesting a role in plant biology as well [PMC2394755]. MIR504 is involved in the regulation of apoptosis and synaptic vesicle regulation, contributing to its relevance in pathological mechanisms [PMC6031650]. In metabolic disorders, MIR504 expression is influenced by high concentrations of glucose and palmitic acid, which can lead to increased inflammation [PMC7123062]. It targets the adaptor GRB10 and transcription factor EGR2, playing a role in vascular smooth myocyte dysfunction among diabetic subjects [PMC7123062]. Furthermore, MIR504 can downregulate p53 expression directly and has been associated with aggressive cancer behavior [PMC9495382]. It also resides within an intron of the Fgf13 gene and forms part of a negative feedback loop with p53 to prevent transcription at the Fgf13 locus [PMC7123062]. Lastly, MIR504 levels have been linked to insulin resistance and diabetes-related hypertension, indicating its potential as an important biomarker for these conditions [PMC8516748].

Literature search
27 open access papers mention hsa-mir-504
(170 sentences)

Sequence

2572 reads, 6 reads per million, 112 experiments
gcugcuguugggAGACCCUGGUCUGCACUCUAUCuguauucuuacugaaGGGAGUGCAGGGCAGGGUUUCccauacagagggc
(((.((((((((((((((((.((((((((((.((.(((....))).))..)))))))))).)))))))))))).))))..)))

Structure
   -g    -            G          -A  u   u 
gcu  cugu ugggAGACCCUG UCUGCACUCU  UC gua u
|||  |||| |||||||||||| ||||||||||  || |||  
cgg  gaca accCUUUGGGAC GGACGUGAGG  ag cau c
   ga    u            G          Ga  u   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 138667711-138667793 [-]

Disease association
hsa-mir-504 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-504-5p

Accession MIMAT0002875
Description Homo sapiens hsa-miR-504-5p mature miRNA
Sequence 13 - AGACCCUGGUCUGCACUCUAUC - 34
Evidence experimental
array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-504-3p

Accession MIMAT0026612
Description Homo sapiens hsa-miR-504-3p mature miRNA
Sequence 50 - GGGAGUGCAGGGCAGGGUUUC - 70
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45