MIR504 is a microRNA that has been implicated in cell cycle regulation via the p53 pathway and has been found to be downregulated in neurological disorders [PMC6031650]. It has been identified as a potential therapeutic target for ALS due to its involvement in apoptosis and synaptic vesicle regulation [PMC6031650]. In wheat, MIR504 is one of the 58 identified wheat miRNAs, and it shows ubiquitous expression in all examined tissues [PMC5360763] [PMC2394755]. It has been found to target wheat unigenes Ta.5303 and Ta.39646, which have two complementary sites for MIR504 [PMC2394755]. The expression of MIR504, along with other wheat miRNAs, has been validated using semi-quantitative RT-PCR [PMC2394755]. In diabetic subjects, MIR504 is upregulated and targets the adaptor GRB10 and transcription factor EGR2 [PMC7123062]. It has also been identified as a p53-related oncomiR that downregulates p53 expression and is associated with aggressive cancer behavior in both human and animal models [PMC9495382]. Exosomal miRs such as MIR504 have been implicated in insulin resistance, diabetes-related hypertension, and vascular dysfunction [PMC8516748]. Transfection experiments have used MIR504 mimic or inhibitor to study its effects on cell culture [PMC8425090]. Future studies are needed to explore the links between obesity-related hormones, MIR504, and p53 [PMC3696069]. Dysregulation of miR-34a and MIR504 has also been observed in various diseases related to synaptic vesicle regulation and cell survival[ PMC6349704]..
-g - G -A u u gcu cugu ugggAGACCCUG UCUGCACUCU UC gua u ||| |||| |||||||||||| |||||||||| || ||| cgg gaca accCUUUGGGAC GGACGUGAGG ag cau c ga u G Ga u u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002875 |
Description | Homo sapiens hsa-miR-504-5p mature miRNA |
Sequence | 13 - AGACCCUGGUCUGCACUCUAUC - 34 |
Evidence |
experimental
array-cloned [1], cloned [2], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0026612 |
Description | Homo sapiens hsa-miR-504-3p mature miRNA |
Sequence | 50 - GGGAGUGCAGGGCAGGGUUUC - 70 |
Evidence |
experimental
Illumina [3] |
|