miRBase entry: hsa-mir-504

Stem-loop hsa-mir-504


Accession
MI0003189
Symbol
HGNC: MIR504
Description
Homo sapiens hsa-mir-504 precursor miRNA
Gene family
MIPF0000437; mir-504

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR504 is a microRNA that has been implicated in cell cycle regulation via the p53 pathway and has been found to be downregulated in neurological disorders [PMC6031650]. It has been identified as a potential therapeutic target for ALS due to its involvement in apoptosis and synaptic vesicle regulation [PMC6031650]. In wheat, MIR504 is one of the 58 identified wheat miRNAs, and it shows ubiquitous expression in all examined tissues [PMC5360763] [PMC2394755]. It has been found to target wheat unigenes Ta.5303 and Ta.39646, which have two complementary sites for MIR504 [PMC2394755]. The expression of MIR504, along with other wheat miRNAs, has been validated using semi-quantitative RT-PCR [PMC2394755]. In diabetic subjects, MIR504 is upregulated and targets the adaptor GRB10 and transcription factor EGR2 [PMC7123062]. It has also been identified as a p53-related oncomiR that downregulates p53 expression and is associated with aggressive cancer behavior in both human and animal models [PMC9495382]. Exosomal miRs such as MIR504 have been implicated in insulin resistance, diabetes-related hypertension, and vascular dysfunction [PMC8516748]. Transfection experiments have used MIR504 mimic or inhibitor to study its effects on cell culture [PMC8425090]. Future studies are needed to explore the links between obesity-related hormones, MIR504, and p53 [PMC3696069]. Dysregulation of miR-34a and MIR504 has also been observed in various diseases related to synaptic vesicle regulation and cell survival[ PMC6349704]..

Literature search
27 open access papers mention hsa-mir-504
(170 sentences)

Sequence

2572 reads, 32 reads per million, 112 experiments
gcugcuguugggAGACCCUGGUCUGCACUCUAUCuguauucuuacugaaGGGAGUGCAGGGCAGGGUUUCccauacagagggc
(((.((((((((((((((((.((((((((((.((.(((....))).))..)))))))))).)))))))))))).))))..)))

Structure
   -g    -            G          -A  u   u 
gcu  cugu ugggAGACCCUG UCUGCACUCU  UC gua u
|||  |||| |||||||||||| ||||||||||  || |||  
cgg  gaca accCUUUGGGAC GGACGUGAGG  ag cau c
   ga    u            G          Ga  u   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 138667711-138667793 [-]

Disease association
hsa-mir-504 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-504-5p

Accession MIMAT0002875
Description Homo sapiens hsa-miR-504-5p mature miRNA
Sequence 13 - AGACCCUGGUCUGCACUCUAUC - 34
Evidence experimental
array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-504-3p

Accession MIMAT0026612
Description Homo sapiens hsa-miR-504-3p mature miRNA
Sequence 50 - GGGAGUGCAGGGCAGGGUUUC - 70
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45